Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WBM82_RS02645 Genome accession   NZ_CP147494
Coordinates   422706..422828 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain YT1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417706..427828
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WBM82_RS02630 (WBM82_02635) yclJ 419320..420003 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  WBM82_RS02635 (WBM82_02640) yclK 419990..421411 (+) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  WBM82_RS02640 (WBM82_02645) rapC 421574..422722 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  WBM82_RS02645 (WBM82_02650) phrC 422706..422828 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WBM82_RS02650 (WBM82_02655) yczM 422928..423017 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WBM82_RS02655 (WBM82_02660) yczN 423099..423212 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  WBM82_RS02660 (WBM82_02665) thrD 423365..424729 (-) 1365 WP_015252822.1 aspartate kinase -
  WBM82_RS02665 (WBM82_02670) ceuB 425113..426063 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  WBM82_RS02670 (WBM82_02675) yclO 426056..427003 (+) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  WBM82_RS02675 (WBM82_02680) yclP 426997..427755 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=946392 WBM82_RS02645 WP_003224994.1 422706..422828(+) (phrC) [Bacillus subtilis strain YT1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=946392 WBM82_RS02645 WP_003224994.1 422706..422828(+) (phrC) [Bacillus subtilis strain YT1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1