Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   Llc71_RS11950 Genome accession   NZ_AP025520
Coordinates   2332738..2333034 (-) Length   98 a.a.
NCBI ID   WP_248536738.1    Uniprot ID   -
Organism   Lactococcus cremoris strain 7-1     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2327738..2338034
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  Llc71_RS11915 (Llc71_23790) - 2328037..2328909 (+) 873 WP_011836037.1 RluA family pseudouridine synthase -
  Llc71_RS11920 (Llc71_23800) - 2328931..2329740 (-) 810 WP_011677177.1 metal ABC transporter permease -
  Llc71_RS11925 (Llc71_23810) - 2329733..2330470 (-) 738 WP_011836039.1 metal ABC transporter ATP-binding protein -
  Llc71_RS11930 (Llc71_23820) - 2330649..2331491 (-) 843 WP_011677179.1 zinc ABC transporter substrate-binding protein -
  Llc71_RS11935 (Llc71_23830) - 2331488..2331925 (-) 438 WP_011836041.1 zinc-dependent MarR family transcriptional regulator -
  Llc71_RS11940 (Llc71_23840) comGG 2332006..2332305 (-) 300 WP_011836042.1 competence type IV pilus minor pilin ComGG Machinery gene
  Llc71_RS11945 (Llc71_23860) comGF 2332329..2332775 (-) 447 WP_011836043.1 competence type IV pilus minor pilin ComGF Machinery gene
  Llc71_RS11950 (Llc71_23870) comGE 2332738..2333034 (-) 297 WP_248536738.1 competence type IV pilus minor pilin ComGE Machinery gene
  Llc71_RS11955 (Llc71_23880) comGD 2333006..2333437 (-) 432 WP_052719845.1 competence type IV pilus minor pilin ComGD Machinery gene
  Llc71_RS11960 (Llc71_23890) comGC 2333397..2333666 (-) 270 WP_042748573.1 competence type IV pilus major pilin ComGC Machinery gene
  Llc71_RS11970 (Llc71_23900) - 2334592..2335029 (-) 438 WP_248536995.1 DUF2335 domain-containing protein -
  Llc71_RS11975 (Llc71_23910) - 2335019..2335246 (-) 228 WP_058225013.1 hypothetical protein -
  Llc71_RS11980 (Llc71_23920) - 2335393..2336172 (-) 780 WP_248536739.1 peptidoglycan amidohydrolase family protein -
  Llc71_RS11985 (Llc71_23930) - 2336172..2336459 (-) 288 WP_023164507.1 phage holin -
  Llc71_RS11990 (Llc71_23940) - 2336471..2336821 (-) 351 WP_248536740.1 hypothetical protein -
  Llc71_RS11995 (Llc71_23950) - 2336834..2337070 (-) 237 WP_248536741.1 hypothetical protein -

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 10976.61 Da        Isoelectric Point: 5.0659

>NTDB_id=92527 Llc71_RS11950 WP_248536738.1 2332738..2333034(-) (comGE) [Lactococcus cremoris strain 7-1]
MENIKRESIKGYILLESLISMALLSFLVTFLLSSLTNSRQQEAQKNQQIESLNVAQMAIESQLTELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=92527 Llc71_RS11950 WP_248536738.1 2332738..2333034(-) (comGE) [Lactococcus cremoris strain 7-1]
GTGGAAAATATAAAAAGAGAATCAATTAAGGGATATATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
AGTCACTTTTCTCTTGAGTTCTCTTACTAATTCTCGTCAGCAAGAGGCACAAAAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGTTGACGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

97.959

100

0.98


Multiple sequence alignment