Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   VDS57_RS11855 Genome accession   NZ_CP141839
Coordinates   2248378..2248500 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PN1236     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2243378..2253500
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  VDS57_RS11840 (VDS57_11840) yclJ 2244991..2245674 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  VDS57_RS11845 (VDS57_11845) yclK 2245661..2247082 (+) 1422 WP_324271385.1 two-component system sensor histidine kinase YclK -
  VDS57_RS11850 (VDS57_11850) rapC 2247246..2248394 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  VDS57_RS11855 (VDS57_11855) phrC 2248378..2248500 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  VDS57_RS11860 (VDS57_11860) yczM 2248600..2248689 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  VDS57_RS11865 (VDS57_11865) yczN 2248771..2248884 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  VDS57_RS11870 (VDS57_11870) thrD 2249038..2250402 (-) 1365 WP_033883679.1 aspartate kinase -
  VDS57_RS11875 (VDS57_11875) ceuB 2250787..2251737 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  VDS57_RS11880 (VDS57_11880) yclO 2251730..2252677 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  VDS57_RS11885 (VDS57_11885) yclP 2252671..2253429 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=920158 VDS57_RS11855 WP_003224994.1 2248378..2248500(+) (phrC) [Bacillus subtilis strain PN1236]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=920158 VDS57_RS11855 WP_003224994.1 2248378..2248500(+) (phrC) [Bacillus subtilis strain PN1236]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1