Detailed information
Overview
| Name | sinI | Type | Regulator |
| Locus tag | RA179_RS12585 | Genome accession | NZ_CP138201 |
| Coordinates | 2477579..2477752 (+) | Length | 57 a.a. |
| NCBI ID | WP_024122036.1 | Uniprot ID | - |
| Organism | Bacillus halotolerans strain DY299 | ||
| Function | inhibit the expression of sinR (predicted from homology) Competence regulation |
||
Genomic Context
Location: 2472579..2482752
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| RA179_RS12570 (RA179_12570) | gcvT | 2473376..2474464 (-) | 1089 | WP_151175141.1 | glycine cleavage system aminomethyltransferase GcvT | - |
| RA179_RS12575 (RA179_12575) | - | 2474908..2476581 (+) | 1674 | WP_127696774.1 | SNF2-related protein | - |
| RA179_RS12580 (RA179_12580) | - | 2476601..2477395 (+) | 795 | WP_127696773.1 | YqhG family protein | - |
| RA179_RS12585 (RA179_12585) | sinI | 2477579..2477752 (+) | 174 | WP_024122036.1 | anti-repressor SinI family protein | Regulator |
| RA179_RS12590 (RA179_12590) | sinR | 2477786..2478121 (+) | 336 | WP_003226345.1 | transcriptional regulator SinR | Regulator |
| RA179_RS12595 (RA179_12595) | tasA | 2478208..2478993 (-) | 786 | WP_106020091.1 | biofilm matrix protein TasA | - |
| RA179_RS12600 (RA179_12600) | - | 2479058..2479642 (-) | 585 | WP_105955579.1 | signal peptidase I | - |
| RA179_RS12605 (RA179_12605) | tapA | 2479614..2480375 (-) | 762 | WP_106020093.1 | amyloid fiber anchoring/assembly protein TapA | - |
| RA179_RS12610 (RA179_12610) | - | 2480653..2480976 (+) | 324 | WP_024122040.1 | YqzG/YhdC family protein | - |
| RA179_RS12615 (RA179_12615) | - | 2481019..2481198 (-) | 180 | WP_003236949.1 | YqzE family protein | - |
| RA179_RS12620 (RA179_12620) | comGG | 2481270..2481644 (-) | 375 | WP_106020094.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| RA179_RS12625 (RA179_12625) | comGF | 2481645..2482028 (-) | 384 | WP_038954226.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| RA179_RS12630 (RA179_12630) | comGE | 2482054..2482401 (-) | 348 | WP_106020095.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 57 a.a. Molecular weight: 6675.62 Da Isoelectric Point: 6.7231
>NTDB_id=901345 RA179_RS12585 WP_024122036.1 2477579..2477752(+) (sinI) [Bacillus halotolerans strain DY299]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
Nucleotide
Download Length: 174 bp
>NTDB_id=901345 RA179_RS12585 WP_024122036.1 2477579..2477752(+) (sinI) [Bacillus halotolerans strain DY299]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| sinI | Bacillus subtilis subsp. subtilis str. 168 |
94.737 |
100 |
0.947 |