Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   R0Q54_RS12660 Genome accession   NZ_CP136992
Coordinates   2389166..2389288 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain J46     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2384166..2394288
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R0Q54_RS12645 (R0Q54_12645) yclJ 2385780..2386463 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  R0Q54_RS12650 (R0Q54_12650) yclK 2386450..2387871 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  R0Q54_RS12655 (R0Q54_12655) rapC 2388034..2389182 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  R0Q54_RS12660 (R0Q54_12660) phrC 2389166..2389288 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  R0Q54_RS12665 (R0Q54_12665) yczM 2389387..2389476 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  R0Q54_RS12670 (R0Q54_12670) yczN 2389558..2389671 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  R0Q54_RS12675 (R0Q54_12675) thrD 2389824..2391188 (-) 1365 WP_021481755.1 aspartate kinase -
  R0Q54_RS12680 (R0Q54_12680) ceuB 2391579..2392529 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  R0Q54_RS12685 (R0Q54_12685) yclO 2392522..2393469 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  R0Q54_RS12690 (R0Q54_12690) yclP 2393463..2394221 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=894060 R0Q54_RS12660 WP_003224994.1 2389166..2389288(+) (phrC) [Bacillus subtilis strain J46]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=894060 R0Q54_RS12660 WP_003224994.1 2389166..2389288(+) (phrC) [Bacillus subtilis strain J46]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1