Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RS399_RS08830 Genome accession   NZ_CP135973
Coordinates   1785162..1785284 (-) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain SI3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1780162..1790284
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RS399_RS08805 (RS399_08805) yclP 1780418..1781176 (-) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -
  RS399_RS08810 (RS399_08810) yclO 1781170..1782117 (-) 948 WP_003240194.1 petrobactin ABC transporter permease YclO -
  RS399_RS08815 (RS399_08815) ceuB 1782110..1783060 (-) 951 WP_084994566.1 petrobactin ABC transporter permease YclN Machinery gene
  RS399_RS08820 (RS399_08820) - 1783444..1784817 (+) 1374 WP_084994563.1 aspartate kinase -
  RS399_RS08825 (RS399_08825) - 1784960..1785067 (+) 108 WP_019257466.1 YjcZ family sporulation protein -
  RS399_RS08830 (RS399_08830) phrC 1785162..1785284 (-) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  RS399_RS08835 (RS399_08835) rapC 1785268..1786416 (-) 1149 WP_019257465.1 response regulator aspartate phosphatase RapC Regulator
  RS399_RS08840 (RS399_08840) yclK 1786579..1787994 (-) 1416 WP_084994560.1 two-component system sensor histidine kinase YclK -
  RS399_RS08845 (RS399_08845) yclJ 1787981..1788664 (-) 684 WP_084994557.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=888008 RS399_RS08830 WP_003240188.1 1785162..1785284(-) (phrC) [Bacillus inaquosorum strain SI3]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=888008 RS399_RS08830 WP_003240188.1 1785162..1785284(-) (phrC) [Bacillus inaquosorum strain SI3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95