Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RFN65_RS18980 Genome accession   NZ_CP133703
Coordinates   3668464..3668586 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain CP35     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3663464..3673586
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RFN65_RS18950 (RFN65_18950) yclP 3663536..3664294 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  RFN65_RS18955 (RFN65_18955) yclO 3664288..3665235 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  RFN65_RS18960 (RFN65_18960) ceuB 3665228..3666178 (-) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  RFN65_RS18965 (RFN65_18965) thrD 3666563..3667927 (+) 1365 WP_063336058.1 aspartate kinase -
  RFN65_RS18970 (RFN65_18970) yczN 3668080..3668193 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  RFN65_RS18975 (RFN65_18975) yczM 3668275..3668364 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  RFN65_RS18980 (RFN65_18980) phrC 3668464..3668586 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  RFN65_RS18985 (RFN65_18985) rapC 3668570..3669718 (-) 1149 WP_251218015.1 response regulator aspartate phosphatase RapC Regulator
  RFN65_RS18990 (RFN65_18990) yclK 3669882..3671303 (-) 1422 WP_080467384.1 two-component system sensor histidine kinase YclK -
  RFN65_RS18995 (RFN65_18995) yclJ 3671290..3671973 (-) 684 WP_063336130.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=875864 RFN65_RS18980 WP_003224994.1 3668464..3668586(-) (phrC) [Bacillus subtilis strain CP35]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=875864 RFN65_RS18980 WP_003224994.1 3668464..3668586(-) (phrC) [Bacillus subtilis strain CP35]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1