Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RA292_RS01675 Genome accession   NZ_CP132912
Coordinates   353723..353845 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. natto strain BN-P15-11-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 348723..358845
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RA292_RS01660 yclJ 350337..351020 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  RA292_RS01665 yclK 351007..352428 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  RA292_RS01670 rapC 352591..353739 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  RA292_RS01675 phrC 353723..353845 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  RA292_RS01680 yczM 353945..354034 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  RA292_RS01685 yczN 354116..354229 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  RA292_RS01690 thrD 354383..355747 (-) 1365 WP_003234493.1 aspartate kinase -
  RA292_RS01695 ceuB 356132..357082 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  RA292_RS01700 yclO 357075..358022 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  RA292_RS01705 yclP 358016..358774 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=870613 RA292_RS01675 WP_003224994.1 353723..353845(+) (phrC) [Bacillus subtilis subsp. natto strain BN-P15-11-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=870613 RA292_RS01675 WP_003224994.1 353723..353845(+) (phrC) [Bacillus subtilis subsp. natto strain BN-P15-11-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1