Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLWG2_RS11515 Genome accession   NZ_CP129660
Coordinates   2221326..2221622 (-) Length   98 a.a.
NCBI ID   WP_021164977.1    Uniprot ID   A0A2Z5Z499
Organism   Lactococcus cremoris strain Wg2     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 2216054..2224284 2221326..2221622 within 0


Gene organization within MGE regions


Location: 2216054..2224284
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLWG2_RS11485 (LLWG2_11540) - 2217520..2218329 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLWG2_RS11490 (LLWG2_11545) - 2218322..2219059 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LLWG2_RS11495 (LLWG2_11550) - 2219238..2220080 (-) 843 WP_021164979.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLWG2_RS11500 (LLWG2_11555) - 2220077..2220514 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLWG2_RS11505 (LLWG2_11560) comGG 2220594..2220821 (-) 228 WP_228764408.1 competence protein ComGG Machinery gene
  LLWG2_RS11510 (LLWG2_11565) comGF 2220917..2221342 (-) 426 WP_014735174.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLWG2_RS11515 (LLWG2_11570) comGE 2221326..2221622 (-) 297 WP_021164977.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLWG2_RS11520 (LLWG2_11575) comGD 2221594..2221782 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LLWG2_RS11525 (LLWG2_11580) comGC 2221984..2222334 (-) 351 WP_050574187.1 competence type IV pilus major pilin ComGC Machinery gene
  LLWG2_RS11530 (LLWG2_11585) comGB 2222379..2223404 (-) 1026 WP_050574185.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLWG2_RS11535 (LLWG2_11590) comGA 2223304..2224284 (-) 981 WP_021164974.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 10958.72 Da        Isoelectric Point: 5.0658

>NTDB_id=854834 LLWG2_RS11515 WP_021164977.1 2221326..2221622(-) (comGE) [Lactococcus cremoris strain Wg2]
MENIKRKSIKGCILLESLISMALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=854834 LLWG2_RS11515 WP_021164977.1 2221326..2221622(-) (comGE) [Lactococcus cremoris strain Wg2]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATGTATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
GGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A2Z5Z499

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

95.918

100

0.959