Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QYC34_RS03545 Genome accession   NZ_CP129338
Coordinates   677621..677743 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM126725     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 672621..682743
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QYC34_RS03530 (QYC34_03530) yclJ 674235..674918 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QYC34_RS03535 (QYC34_03535) yclK 674905..676326 (+) 1422 WP_153952928.1 two-component system sensor histidine kinase YclK -
  QYC34_RS03540 (QYC34_03540) rapC 676489..677637 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QYC34_RS03545 (QYC34_03545) phrC 677621..677743 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QYC34_RS03550 (QYC34_03550) yczM 677843..677932 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QYC34_RS03555 (QYC34_03555) yczN 678014..678127 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  QYC34_RS03560 (QYC34_03560) thrD 678280..679644 (-) 1365 WP_032726529.1 aspartate kinase -
  QYC34_RS03565 (QYC34_03565) ceuB 680029..680979 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  QYC34_RS03570 (QYC34_03570) yclO 680972..681919 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QYC34_RS03575 (QYC34_03575) yclP 681913..682671 (+) 759 WP_046160055.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=852312 QYC34_RS03545 WP_003224994.1 677621..677743(+) (phrC) [Bacillus subtilis strain SRCM126725]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=852312 QYC34_RS03545 WP_003224994.1 677621..677743(+) (phrC) [Bacillus subtilis strain SRCM126725]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1