Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   QLQ02_RS16125 Genome accession   NZ_CP127833
Coordinates   3115173..3115346 (-) Length   57 a.a.
NCBI ID   WP_010334916.1    Uniprot ID   -
Organism   Bacillus mojavensis strain KRS009     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 3110173..3120346
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QLQ02_RS16080 comGE 3110524..3110871 (+) 348 WP_286058319.1 competence type IV pilus minor pilin ComGE Machinery gene
  QLQ02_RS16085 comGF 3110873..3111280 (+) 408 WP_286058320.1 competence type IV pilus minor pilin ComGF Machinery gene
  QLQ02_RS16090 comGG 3111281..3111655 (+) 375 WP_286058321.1 competence type IV pilus minor pilin ComGG Machinery gene
  QLQ02_RS16095 - 3111727..3111906 (+) 180 WP_003236949.1 YqzE family protein -
  QLQ02_RS16100 - 3111949..3112272 (-) 324 WP_168748230.1 YqzG/YhdC family protein -
  QLQ02_RS16105 tapA 3112549..3113310 (+) 762 WP_268451136.1 amyloid fiber anchoring/assembly protein TapA -
  QLQ02_RS16110 - 3113282..3113866 (+) 585 WP_286058322.1 signal peptidase I SipW -
  QLQ02_RS16115 tasA 3113931..3114716 (+) 786 WP_010334917.1 biofilm matrix protein TasA -
  QLQ02_RS16120 sinR 3114804..3115139 (-) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  QLQ02_RS16125 sinI 3115173..3115346 (-) 174 WP_010334916.1 anti-repressor SinI Regulator
  QLQ02_RS16130 - 3115526..3116320 (-) 795 WP_168748226.1 YqhG family protein -
  QLQ02_RS16135 - 3116341..3118014 (-) 1674 WP_268504993.1 SNF2-related protein -
  QLQ02_RS16140 gcvT 3118457..3119545 (+) 1089 WP_286058323.1 glycine cleavage system aminomethyltransferase GcvT -

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6687.63 Da        Isoelectric Point: 6.4604

>NTDB_id=844474 QLQ02_RS16125 WP_010334916.1 3115173..3115346(-) (sinI) [Bacillus mojavensis strain KRS009]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=844474 QLQ02_RS16125 WP_010334916.1 3115173..3115346(-) (sinI) [Bacillus mojavensis strain KRS009]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947