Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QMC72_RS13355 Genome accession   NZ_CP127095
Coordinates   2569082..2569204 (-) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain LBA001     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2564082..2574204
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QMC72_RS13330 (QMC72_13330) yclP 2564336..2565094 (-) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -
  QMC72_RS13335 (QMC72_13335) yclO 2565088..2566035 (-) 948 WP_060397923.1 petrobactin ABC transporter permease YclO -
  QMC72_RS13340 (QMC72_13340) ceuB 2566028..2566978 (-) 951 WP_084994566.1 petrobactin ABC transporter permease YclN Machinery gene
  QMC72_RS13345 (QMC72_13345) - 2567363..2568736 (+) 1374 WP_268274762.1 aspartate kinase -
  QMC72_RS13350 (QMC72_13350) - 2568879..2568986 (+) 108 WP_019257466.1 YjcZ family sporulation protein -
  QMC72_RS13355 (QMC72_13355) phrC 2569082..2569204 (-) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  QMC72_RS13360 (QMC72_13360) rapC 2569188..2570336 (-) 1149 WP_019257465.1 response regulator aspartate phosphatase RapC Regulator
  QMC72_RS13365 (QMC72_13365) - 2570499..2571914 (-) 1416 WP_284107085.1 HAMP domain-containing sensor histidine kinase -
  QMC72_RS13370 (QMC72_13370) yclJ 2571901..2572584 (-) 684 WP_003240180.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=841690 QMC72_RS13355 WP_003240188.1 2569082..2569204(-) (phrC) [Bacillus inaquosorum strain LBA001]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=841690 QMC72_RS13355 WP_003240188.1 2569082..2569204(-) (phrC) [Bacillus inaquosorum strain LBA001]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95