Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   QPL78_RS12670 Genome accession   NZ_CP126530
Coordinates   2473591..2473764 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain Tehuacan_S4     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2468591..2478764
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QPL78_RS12655 (QPL78_12655) gcvT 2469388..2470476 (-) 1089 WP_101864522.1 glycine cleavage system aminomethyltransferase GcvT -
  QPL78_RS12660 (QPL78_12660) - 2470920..2472593 (+) 1674 WP_101864657.1 SNF2-related protein -
  QPL78_RS12665 (QPL78_12665) - 2472613..2473407 (+) 795 WP_101864523.1 YqhG family protein -
  QPL78_RS12670 (QPL78_12670) sinI 2473591..2473764 (+) 174 WP_024122036.1 anti-repressor SinI family protein Regulator
  QPL78_RS12675 (QPL78_12675) sinR 2473798..2474133 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  QPL78_RS12680 (QPL78_12680) tasA 2474220..2475005 (-) 786 WP_101864524.1 biofilm matrix protein TasA -
  QPL78_RS12685 (QPL78_12685) - 2475070..2475654 (-) 585 WP_284559282.1 signal peptidase I -
  QPL78_RS12690 (QPL78_12690) tapA 2475626..2476387 (-) 762 WP_284559283.1 amyloid fiber anchoring/assembly protein TapA -
  QPL78_RS12695 (QPL78_12695) - 2476664..2476987 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  QPL78_RS12700 (QPL78_12700) - 2477030..2477209 (-) 180 WP_003236949.1 YqzE family protein -
  QPL78_RS12705 (QPL78_12705) comGG 2477281..2477655 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  QPL78_RS12710 (QPL78_12710) comGF 2477656..2478039 (-) 384 WP_284559284.1 competence type IV pilus minor pilin ComGF Machinery gene
  QPL78_RS12715 (QPL78_12715) comGE 2478065..2478412 (-) 348 WP_284559285.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=838487 QPL78_RS12670 WP_024122036.1 2473591..2473764(+) (sinI) [Bacillus halotolerans strain Tehuacan_S4]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=838487 QPL78_RS12670 WP_024122036.1 2473591..2473764(+) (sinI) [Bacillus halotolerans strain Tehuacan_S4]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947