Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QPL78_RS02200 Genome accession   NZ_CP126530
Coordinates   436035..436157 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain Tehuacan_S4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 431035..441157
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QPL78_RS02185 (QPL78_02185) - 432637..433320 (+) 684 WP_284560189.1 response regulator transcription factor -
  QPL78_RS02190 (QPL78_02190) - 433307..434731 (+) 1425 WP_101860980.1 HAMP domain-containing sensor histidine kinase -
  QPL78_RS02195 (QPL78_02195) rapC 434903..436051 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  QPL78_RS02200 (QPL78_02200) phrC 436035..436157 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  QPL78_RS02205 (QPL78_02205) - 436262..436354 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  QPL78_RS02210 (QPL78_02210) - 436501..436611 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  QPL78_RS02215 (QPL78_02215) - 436763..438127 (-) 1365 WP_095714086.1 aspartate kinase -
  QPL78_RS02220 (QPL78_02220) ceuB 438513..439463 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  QPL78_RS02225 (QPL78_02225) yclO 439456..440403 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  QPL78_RS02230 (QPL78_02230) yclP 440397..441155 (+) 759 WP_095714087.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=838456 QPL78_RS02200 WP_024120213.1 436035..436157(+) (phrC) [Bacillus halotolerans strain Tehuacan_S4]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=838456 QPL78_RS02200 WP_024120213.1 436035..436157(+) (phrC) [Bacillus halotolerans strain Tehuacan_S4]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875