Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QI003_RS02145 Genome accession   NZ_CP124601
Coordinates   427049..427171 (+) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus stercoris strain BS21     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422049..432171
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QI003_RS02130 (QI003_02130) yclJ 423663..424346 (+) 684 WP_041521471.1 two-component system response regulator YclJ -
  QI003_RS02135 (QI003_02135) yclK 424333..425754 (+) 1422 WP_103031555.1 two-component system sensor histidine kinase YclK -
  QI003_RS02140 (QI003_02140) rapC 425917..427065 (+) 1149 WP_014662770.1 response regulator aspartate phosphatase RapC Regulator
  QI003_RS02145 (QI003_02145) phrC 427049..427171 (+) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  QI003_RS02150 (QI003_02150) - 427269..427379 (-) 111 WP_040084173.1 YjcZ family sporulation protein -
  QI003_RS02155 (QI003_02155) - 427522..428886 (-) 1365 WP_014662772.1 aspartate kinase -
  QI003_RS02160 (QI003_02160) ceuB 429271..430221 (+) 951 WP_014662773.1 petrobactin ABC transporter permease YclN Machinery gene
  QI003_RS02165 (QI003_02165) yclO 430214..431161 (+) 948 WP_282373968.1 petrobactin ABC transporter permease YclO -
  QI003_RS02170 (QI003_02170) yclP 431155..431913 (+) 759 WP_014662775.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=826587 QI003_RS02145 WP_014662771.1 427049..427171(+) (phrC) [Bacillus stercoris strain BS21]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=826587 QI003_RS02145 WP_014662771.1 427049..427171(+) (phrC) [Bacillus stercoris strain BS21]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975