Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QA442_RS20425 Genome accession   NZ_CP121861
Coordinates   3940016..3940138 (-) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus stercoris strain Mal05     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3935016..3945138
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QA442_RS20400 (QA442_20400) yclP 3935274..3936032 (-) 759 WP_095432788.1 petrobactin ABC transporter ATP-binding protein YclP -
  QA442_RS20405 (QA442_20405) yclO 3936026..3936973 (-) 948 WP_040084169.1 petrobactin ABC transporter permease YclO -
  QA442_RS20410 (QA442_20410) ceuB 3936966..3937916 (-) 951 WP_014662773.1 petrobactin ABC transporter permease YclN Machinery gene
  QA442_RS20415 (QA442_20415) - 3938301..3939665 (+) 1365 WP_069839855.1 aspartate kinase -
  QA442_RS20420 (QA442_20420) - 3939808..3939918 (+) 111 WP_040084173.1 YjcZ family sporulation protein -
  QA442_RS20425 (QA442_20425) phrC 3940016..3940138 (-) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  QA442_RS20430 (QA442_20430) rapC 3940122..3941270 (-) 1149 WP_095432789.1 response regulator aspartate phosphatase RapC Regulator
  QA442_RS20435 (QA442_20435) yclK 3941433..3942854 (-) 1422 WP_095432790.1 two-component system sensor histidine kinase YclK -
  QA442_RS20440 (QA442_20440) yclJ 3942841..3943524 (-) 684 WP_041521471.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=814938 QA442_RS20425 WP_014662771.1 3940016..3940138(-) (phrC) [Bacillus stercoris strain Mal05]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=814938 QA442_RS20425 WP_014662771.1 3940016..3940138(-) (phrC) [Bacillus stercoris strain Mal05]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A292GN16

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975