Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   P5628_RS02055 Genome accession   NZ_CP120577
Coordinates   406038..406160 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PRO53     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 401038..411160
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5628_RS02040 (P5628_02040) yclJ 402652..403335 (+) 684 WP_277709254.1 two-component system response regulator YclJ -
  P5628_RS02045 (P5628_02045) yclK 403322..404743 (+) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  P5628_RS02050 (P5628_02050) rapC 404906..406054 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  P5628_RS02055 (P5628_02055) phrC 406038..406160 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5628_RS02060 (P5628_02060) yczM 406260..406349 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5628_RS02065 (P5628_02065) yczN 406431..406544 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5628_RS02070 (P5628_02070) thrD 406698..408062 (-) 1365 WP_122895034.1 aspartate kinase -
  P5628_RS02075 (P5628_02075) ceuB 408447..409397 (+) 951 WP_014662773.1 petrobactin ABC transporter permease YclN Machinery gene
  P5628_RS02080 (P5628_02080) yclO 409390..410337 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  P5628_RS02085 (P5628_02085) yclP 410331..411089 (+) 759 WP_161621347.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=806275 P5628_RS02055 WP_003224994.1 406038..406160(+) (phrC) [Bacillus subtilis strain PRO53]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=806275 P5628_RS02055 WP_003224994.1 406038..406160(+) (phrC) [Bacillus subtilis strain PRO53]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1