Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   P3L57_RS12325 Genome accession   NZ_CP120511
Coordinates   2504448..2504621 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus sp. B28     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2499448..2509621
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P3L57_RS12310 (P3L57_12310) gcvT 2500245..2501333 (-) 1089 WP_069487188.1 glycine cleavage system aminomethyltransferase GcvT -
  P3L57_RS12315 (P3L57_12315) - 2501777..2503450 (+) 1674 WP_059293610.1 SNF2-related protein -
  P3L57_RS12320 (P3L57_12320) - 2503470..2504264 (+) 795 WP_044154602.1 YqhG family protein -
  P3L57_RS12325 (P3L57_12325) sinI 2504448..2504621 (+) 174 WP_024122036.1 anti-repressor SinI family protein Regulator
  P3L57_RS12330 (P3L57_12330) sinR 2504655..2504990 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  P3L57_RS12335 (P3L57_12335) tasA 2505076..2505861 (-) 786 WP_059293609.1 biofilm matrix protein TasA -
  P3L57_RS12340 (P3L57_12340) - 2505926..2506510 (-) 585 WP_059293608.1 signal peptidase I -
  P3L57_RS12345 (P3L57_12345) tapA 2506482..2507243 (-) 762 WP_069487187.1 amyloid fiber anchoring/assembly protein TapA -
  P3L57_RS12350 (P3L57_12350) - 2507520..2507843 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  P3L57_RS12355 (P3L57_12355) - 2507886..2508065 (-) 180 WP_003236949.1 YqzE family protein -
  P3L57_RS12360 (P3L57_12360) comGG 2508137..2508511 (-) 375 WP_059335411.1 competence type IV pilus minor pilin ComGG Machinery gene
  P3L57_RS12365 (P3L57_12365) comGF 2508512..2508895 (-) 384 WP_175422400.1 competence type IV pilus minor pilin ComGF Machinery gene
  P3L57_RS12370 (P3L57_12370) comGE 2508921..2509268 (-) 348 WP_069487185.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=805927 P3L57_RS12325 WP_024122036.1 2504448..2504621(+) (sinI) [Bacillus sp. B28]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=805927 P3L57_RS12325 WP_024122036.1 2504448..2504621(+) (sinI) [Bacillus sp. B28]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947