Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   PZB78_RS20835 Genome accession   NZ_CP119073
Coordinates   4063209..4063331 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain SW207     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 4058209..4068331
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PZB78_RS20820 (PZB78_20800) - 4059814..4060497 (+) 684 WP_254518038.1 response regulator transcription factor -
  PZB78_RS20825 (PZB78_20805) - 4060484..4061908 (+) 1425 WP_286109135.1 HAMP domain-containing sensor histidine kinase -
  PZB78_RS20830 (PZB78_20810) rapC 4062077..4063225 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  PZB78_RS20835 (PZB78_20815) phrC 4063209..4063331 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  PZB78_RS20840 (PZB78_20820) - 4063436..4063528 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  PZB78_RS20845 (PZB78_20825) - 4063675..4063785 (-) 111 WP_106021023.1 YjcZ family sporulation protein -
  PZB78_RS20850 (PZB78_20830) - 4063938..4065302 (-) 1365 WP_095714086.1 aspartate kinase -
  PZB78_RS20855 (PZB78_20835) ceuB 4065688..4066638 (+) 951 WP_106021021.1 petrobactin ABC transporter permease YclN Machinery gene
  PZB78_RS20860 (PZB78_20840) yclO 4066631..4067578 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  PZB78_RS20865 (PZB78_20845) yclP 4067572..4068330 (+) 759 WP_106021019.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=797524 PZB78_RS20835 WP_024120213.1 4063209..4063331(+) (phrC) [Bacillus halotolerans strain SW207]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=797524 PZB78_RS20835 WP_024120213.1 4063209..4063331(+) (phrC) [Bacillus halotolerans strain SW207]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875