Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   PZB78_RS10025 Genome accession   NZ_CP119073
Coordinates   1965416..1965589 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain SW207     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 1960416..1970589
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PZB78_RS10010 (PZB78_09975) gcvT 1961214..1962302 (-) 1089 WP_151175141.1 glycine cleavage system aminomethyltransferase GcvT -
  PZB78_RS10015 (PZB78_09980) - 1962745..1964418 (+) 1674 WP_127696774.1 DEAD/DEAH box helicase -
  PZB78_RS10020 (PZB78_09985) - 1964438..1965232 (+) 795 WP_127696773.1 YqhG family protein -
  PZB78_RS10025 (PZB78_09990) sinI 1965416..1965589 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  PZB78_RS10030 (PZB78_09995) sinR 1965623..1965958 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  PZB78_RS10035 (PZB78_10000) tasA 1966045..1966830 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  PZB78_RS10040 (PZB78_10005) sipW 1966895..1967479 (-) 585 WP_105955579.1 signal peptidase I SipW -
  PZB78_RS10045 (PZB78_10010) tapA 1967451..1968212 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  PZB78_RS10050 (PZB78_10015) - 1968490..1968813 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  PZB78_RS10055 (PZB78_10020) - 1968856..1969035 (-) 180 WP_003236949.1 YqzE family protein -
  PZB78_RS10060 (PZB78_10025) comGG 1969107..1969481 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  PZB78_RS10065 (PZB78_10030) comGF 1969482..1969865 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  PZB78_RS10070 (PZB78_10035) comGE 1969891..1970238 (-) 348 WP_106020095.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=797475 PZB78_RS10025 WP_024122036.1 1965416..1965589(+) (sinI) [Bacillus halotolerans strain SW207]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=797475 PZB78_RS10025 WP_024122036.1 1965416..1965589(+) (sinI) [Bacillus halotolerans strain SW207]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947