Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   PUN35_RS12720 Genome accession   NZ_CP117986
Coordinates   2336647..2336769 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. N3378-2at     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2331647..2341769
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PUN35_RS12690 yclP 2331714..2332472 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  PUN35_RS12695 yclO 2332466..2333413 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  PUN35_RS12700 ceuB 2333406..2334356 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  PUN35_RS12705 - 2334747..2336111 (+) 1365 WP_014478832.1 aspartate kinase -
  PUN35_RS12710 - 2336264..2336377 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  PUN35_RS12715 - 2336459..2336548 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  PUN35_RS12720 phrC 2336647..2336769 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PUN35_RS12725 rapC 2336753..2337901 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  PUN35_RS12730 yclK 2338064..2339485 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  PUN35_RS12735 yclJ 2339472..2340155 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=788910 PUN35_RS12720 WP_003224994.1 2336647..2336769(-) (phrC) [Bacillus sp. N3378-2at]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=788910 PUN35_RS12720 WP_003224994.1 2336647..2336769(-) (phrC) [Bacillus sp. N3378-2at]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1