Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   PPM66_RS01525 Genome accession   NZ_CP116867
Coordinates   299288..299410 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain MGP008     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 294288..304410
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PPM66_RS01510 yclJ 295902..296585 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  PPM66_RS01515 yclK 296572..297993 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  PPM66_RS01520 rapC 298156..299304 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  PPM66_RS01525 phrC 299288..299410 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PPM66_RS01530 yczM 299510..299599 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  PPM66_RS01535 yczN 299681..299794 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  PPM66_RS01540 thrD 299948..301312 (-) 1365 WP_009966541.1 aspartate kinase -
  PPM66_RS01545 ceuB 301697..302647 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  PPM66_RS01550 yclO 302640..303587 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  PPM66_RS01555 yclP 303581..304339 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=780427 PPM66_RS01525 WP_003224994.1 299288..299410(+) (phrC) [Bacillus subtilis subsp. subtilis strain MGP008]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=780427 PPM66_RS01525 WP_003224994.1 299288..299410(+) (phrC) [Bacillus subtilis subsp. subtilis strain MGP008]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1