Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   PNF29_RS19280 Genome accession   NZ_CP116773
Coordinates   3632385..3632507 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM125727     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3627385..3637507
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PNF29_RS19250 (PNF29_19250) yclP 3627457..3628215 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  PNF29_RS19255 (PNF29_19255) yclO 3628209..3629156 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  PNF29_RS19260 (PNF29_19260) ceuB 3629149..3630099 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  PNF29_RS19265 (PNF29_19265) thrD 3630484..3631848 (+) 1365 WP_041340152.1 aspartate kinase -
  PNF29_RS19270 (PNF29_19270) yczN 3632001..3632114 (+) 114 WP_272515747.1 YjcZ family sporulation protein -
  PNF29_RS19275 (PNF29_19275) yczM 3632196..3632285 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  PNF29_RS19280 (PNF29_19280) phrC 3632385..3632507 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PNF29_RS19285 (PNF29_19285) rapC 3632491..3633639 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  PNF29_RS19290 (PNF29_19290) yclK 3633802..3635223 (-) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  PNF29_RS19295 (PNF29_19295) yclJ 3635210..3635893 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=780141 PNF29_RS19280 WP_003224994.1 3632385..3632507(-) (phrC) [Bacillus subtilis strain SRCM125727]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=780141 PNF29_RS19280 WP_003224994.1 3632385..3632507(-) (phrC) [Bacillus subtilis strain SRCM125727]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1