Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   PF977_RS20555 Genome accession   NZ_CP116012
Coordinates   3877927..3878049 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM124333     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3872927..3883049
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PF977_RS20525 (PF977_20525) yclP 3872999..3873757 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  PF977_RS20530 (PF977_20530) yclO 3873751..3874698 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  PF977_RS20535 (PF977_20535) ceuB 3874691..3875641 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  PF977_RS20540 (PF977_20540) thrD 3876026..3877390 (+) 1365 WP_015715246.1 aspartate kinase -
  PF977_RS20545 (PF977_20545) yczN 3877543..3877656 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  PF977_RS20550 (PF977_20550) yczM 3877738..3877827 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  PF977_RS20555 (PF977_20555) phrC 3877927..3878049 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PF977_RS20560 (PF977_20560) rapC 3878033..3879181 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  PF977_RS20565 (PF977_20565) yclK 3879344..3880765 (-) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  PF977_RS20570 (PF977_20570) yclJ 3880752..3881435 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=775141 PF977_RS20555 WP_003224994.1 3877927..3878049(-) (phrC) [Bacillus subtilis strain SRCM124333]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=775141 PF977_RS20555 WP_003224994.1 3877927..3878049(-) (phrC) [Bacillus subtilis strain SRCM124333]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1