Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   OMK57_RS02185 Genome accession   NZ_CP110264
Coordinates   431266..431388 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain HMB20199     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 426266..436388
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OMK57_RS02170 (OMK57_02170) yclJ 427868..428551 (+) 684 WP_024120210.1 two-component system response regulator YclJ -
  OMK57_RS02175 (OMK57_02175) - 428538..429947 (+) 1410 WP_082687805.1 HAMP domain-containing sensor histidine kinase -
  OMK57_RS02180 (OMK57_02180) rapC 430134..431282 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  OMK57_RS02185 (OMK57_02185) phrC 431266..431388 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  OMK57_RS02190 (OMK57_02190) - 431493..431585 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  OMK57_RS02195 (OMK57_02195) - 431732..431842 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  OMK57_RS02200 (OMK57_02200) - 431995..433359 (-) 1365 WP_069487496.1 aspartate kinase -
  OMK57_RS02205 (OMK57_02205) ceuB 433745..434695 (+) 951 WP_044161881.1 petrobactin ABC transporter permease YclN Machinery gene
  OMK57_RS02210 (OMK57_02210) yclO 434688..435635 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  OMK57_RS02215 (OMK57_02215) yclP 435629..436387 (+) 759 WP_044161880.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=753535 OMK57_RS02185 WP_010333023.1 431266..431388(+) (phrC) [Bacillus halotolerans strain HMB20199]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=753535 OMK57_RS02185 WP_010333023.1 431266..431388(+) (phrC) [Bacillus halotolerans strain HMB20199]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9