Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   OKW88_RS16865 Genome accession   NZ_CP110105
Coordinates   3294850..3294972 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain CF03     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3289850..3299972
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OKW88_RS16850 (OKW88_16830) yclJ 3291464..3292147 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  OKW88_RS16855 (OKW88_16835) yclK 3292134..3293555 (+) 1422 WP_122895032.1 two-component system sensor histidine kinase YclK -
  OKW88_RS16860 (OKW88_16840) rapC 3293718..3294866 (+) 1149 WP_122895033.1 response regulator aspartate phosphatase RapC Regulator
  OKW88_RS16865 (OKW88_16845) phrC 3294850..3294972 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  OKW88_RS16870 (OKW88_16850) yczM 3295072..3295161 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  OKW88_RS16875 (OKW88_16855) yczN 3295243..3295356 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  OKW88_RS16880 (OKW88_16860) thrD 3295509..3296873 (-) 1365 WP_342006778.1 aspartate kinase -
  OKW88_RS16885 (OKW88_16865) ceuB 3297258..3298208 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  OKW88_RS16890 (OKW88_16870) yclO 3298201..3299148 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  OKW88_RS16895 (OKW88_16875) yclP 3299142..3299900 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=752305 OKW88_RS16865 WP_003224994.1 3294850..3294972(+) (phrC) [Bacillus subtilis strain CF03]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=752305 OKW88_RS16865 WP_003224994.1 3294850..3294972(+) (phrC) [Bacillus subtilis strain CF03]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1