Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   N7980_RS18985 Genome accession   NZ_CP106671
Coordinates   3672216..3672338 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM116301     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3667216..3677338
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N7980_RS18955 (N7980_18955) yclP 3667285..3668043 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  N7980_RS18960 (N7980_18960) yclO 3668037..3668984 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  N7980_RS18965 (N7980_18965) ceuB 3668977..3669927 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  N7980_RS18970 (N7980_18970) thrD 3670312..3671676 (+) 1365 WP_043940054.1 aspartate kinase -
  N7980_RS18975 (N7980_18975) yczN 3671830..3671943 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  N7980_RS18980 (N7980_18980) yczM 3672025..3672114 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  N7980_RS18985 (N7980_18985) phrC 3672216..3672338 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N7980_RS18990 (N7980_18990) rapC 3672322..3673470 (-) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  N7980_RS18995 (N7980_18995) yclK 3673634..3675055 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  N7980_RS19000 (N7980_19000) yclJ 3675042..3675725 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=733917 N7980_RS18985 WP_003224994.1 3672216..3672338(-) (phrC) [Bacillus subtilis strain SRCM116301]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=733917 N7980_RS18985 WP_003224994.1 3672216..3672338(-) (phrC) [Bacillus subtilis strain SRCM116301]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1