Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NPA28_RS02170 Genome accession   NZ_CP101718
Coordinates   427414..427536 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain S-5     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422414..432536
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NPA28_RS02155 (NPA28_02155) yclJ 424016..424699 (+) 684 WP_024120210.1 two-component system response regulator YclJ -
  NPA28_RS02160 (NPA28_02160) - 424686..426095 (+) 1410 WP_082687805.1 HAMP domain-containing sensor histidine kinase -
  NPA28_RS02165 (NPA28_02165) rapC 426282..427430 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  NPA28_RS02170 (NPA28_02170) phrC 427414..427536 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NPA28_RS02175 (NPA28_02175) - 427641..427733 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  NPA28_RS02180 (NPA28_02180) - 427880..427990 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  NPA28_RS02185 (NPA28_02185) - 428143..429507 (-) 1365 WP_069487496.1 aspartate kinase -
  NPA28_RS02190 (NPA28_02190) ceuB 429893..430843 (+) 951 WP_099043690.1 petrobactin ABC transporter permease YclN Machinery gene
  NPA28_RS02195 (NPA28_02195) yclO 430836..431783 (+) 948 WP_227534189.1 petrobactin ABC transporter permease YclO -
  NPA28_RS02200 (NPA28_02200) yclP 431777..432535 (+) 759 WP_024120218.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=711729 NPA28_RS02170 WP_010333023.1 427414..427536(+) (phrC) [Bacillus halotolerans strain S-5]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=711729 NPA28_RS02170 WP_010333023.1 427414..427536(+) (phrC) [Bacillus halotolerans strain S-5]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9