Detailed information
Overview
| Name | sinI | Type | Regulator |
| Locus tag | NLV76_RS12715 | Genome accession | NZ_CP100752 |
| Coordinates | 2481866..2482039 (+) | Length | 57 a.a. |
| NCBI ID | WP_024122036.1 | Uniprot ID | - |
| Organism | Bacillus halotolerans strain MEC_B301 | ||
| Function | inhibit the expression of sinR (predicted from homology) Competence regulation |
||
Genomic Context
Location: 2476866..2487039
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NLV76_RS12700 (NLV76_12700) | gcvT | 2477663..2478751 (-) | 1089 | WP_254500937.1 | glycine cleavage system aminomethyltransferase GcvT | - |
| NLV76_RS12705 (NLV76_12705) | - | 2479195..2480868 (+) | 1674 | WP_254500938.1 | DEAD/DEAH box helicase | - |
| NLV76_RS12710 (NLV76_12710) | - | 2480888..2481682 (+) | 795 | WP_254500939.1 | YqhG family protein | - |
| NLV76_RS12715 (NLV76_12715) | sinI | 2481866..2482039 (+) | 174 | WP_024122036.1 | anti-repressor SinI | Regulator |
| NLV76_RS12720 (NLV76_12720) | sinR | 2482073..2482408 (+) | 336 | WP_254500940.1 | transcriptional regulator SinR | Regulator |
| NLV76_RS12725 (NLV76_12725) | tasA | 2482495..2483280 (-) | 786 | WP_254500941.1 | biofilm matrix protein TasA | - |
| NLV76_RS12730 (NLV76_12730) | sipW | 2483345..2483929 (-) | 585 | WP_059293608.1 | signal peptidase I SipW | - |
| NLV76_RS12735 (NLV76_12735) | tapA | 2483901..2484662 (-) | 762 | WP_254500942.1 | amyloid fiber anchoring/assembly protein TapA | - |
| NLV76_RS12740 (NLV76_12740) | - | 2484939..2485262 (+) | 324 | WP_254500943.1 | YqzG/YhdC family protein | - |
| NLV76_RS12745 (NLV76_12745) | - | 2485305..2485484 (-) | 180 | WP_003236949.1 | YqzE family protein | - |
| NLV76_RS12750 (NLV76_12750) | comGG | 2485556..2485930 (-) | 375 | WP_059335411.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| NLV76_RS12755 (NLV76_12755) | comGF | 2485931..2486314 (-) | 384 | WP_227533974.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| NLV76_RS12760 (NLV76_12760) | comGE | 2486340..2486687 (-) | 348 | WP_059352380.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 57 a.a. Molecular weight: 6675.62 Da Isoelectric Point: 6.7231
>NTDB_id=706684 NLV76_RS12715 WP_024122036.1 2481866..2482039(+) (sinI) [Bacillus halotolerans strain MEC_B301]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
Nucleotide
Download Length: 174 bp
>NTDB_id=706684 NLV76_RS12715 WP_024122036.1 2481866..2482039(+) (sinI) [Bacillus halotolerans strain MEC_B301]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| sinI | Bacillus subtilis subsp. subtilis str. 168 |
94.737 |
100 |
0.947 |