Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NLV76_RS12715 Genome accession   NZ_CP100752
Coordinates   2481866..2482039 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain MEC_B301     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2476866..2487039
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NLV76_RS12700 (NLV76_12700) gcvT 2477663..2478751 (-) 1089 WP_254500937.1 glycine cleavage system aminomethyltransferase GcvT -
  NLV76_RS12705 (NLV76_12705) - 2479195..2480868 (+) 1674 WP_254500938.1 DEAD/DEAH box helicase -
  NLV76_RS12710 (NLV76_12710) - 2480888..2481682 (+) 795 WP_254500939.1 YqhG family protein -
  NLV76_RS12715 (NLV76_12715) sinI 2481866..2482039 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  NLV76_RS12720 (NLV76_12720) sinR 2482073..2482408 (+) 336 WP_254500940.1 transcriptional regulator SinR Regulator
  NLV76_RS12725 (NLV76_12725) tasA 2482495..2483280 (-) 786 WP_254500941.1 biofilm matrix protein TasA -
  NLV76_RS12730 (NLV76_12730) sipW 2483345..2483929 (-) 585 WP_059293608.1 signal peptidase I SipW -
  NLV76_RS12735 (NLV76_12735) tapA 2483901..2484662 (-) 762 WP_254500942.1 amyloid fiber anchoring/assembly protein TapA -
  NLV76_RS12740 (NLV76_12740) - 2484939..2485262 (+) 324 WP_254500943.1 YqzG/YhdC family protein -
  NLV76_RS12745 (NLV76_12745) - 2485305..2485484 (-) 180 WP_003236949.1 YqzE family protein -
  NLV76_RS12750 (NLV76_12750) comGG 2485556..2485930 (-) 375 WP_059335411.1 competence type IV pilus minor pilin ComGG Machinery gene
  NLV76_RS12755 (NLV76_12755) comGF 2485931..2486314 (-) 384 WP_227533974.1 competence type IV pilus minor pilin ComGF Machinery gene
  NLV76_RS12760 (NLV76_12760) comGE 2486340..2486687 (-) 348 WP_059352380.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=706684 NLV76_RS12715 WP_024122036.1 2481866..2482039(+) (sinI) [Bacillus halotolerans strain MEC_B301]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=706684 NLV76_RS12715 WP_024122036.1 2481866..2482039(+) (sinI) [Bacillus halotolerans strain MEC_B301]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947