Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NDR85_RS02180 Genome accession   NZ_CP098738
Coordinates   431549..431671 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus halotolerans strain XE48     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 426549..436671
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NDR85_RS02165 (NDR85_02165) yclJ 428151..428834 (+) 684 WP_024120210.1 two-component system response regulator YclJ -
  NDR85_RS02170 (NDR85_02170) - 428821..430230 (+) 1410 WP_082687805.1 HAMP domain-containing sensor histidine kinase -
  NDR85_RS02175 (NDR85_02175) rapC 430417..431565 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  NDR85_RS02180 (NDR85_02180) phrC 431549..431671 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NDR85_RS02185 (NDR85_02185) - 431776..431868 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  NDR85_RS02190 (NDR85_02190) - 432015..432125 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  NDR85_RS02195 (NDR85_02195) - 432278..433642 (-) 1365 WP_069487496.1 aspartate kinase -
  NDR85_RS02200 (NDR85_02200) ceuB 434028..434978 (+) 951 WP_263870872.1 petrobactin ABC transporter permease YclN Machinery gene
  NDR85_RS02205 (NDR85_02205) yclO 434971..435918 (+) 948 WP_263870873.1 petrobactin ABC transporter permease YclO -
  NDR85_RS02210 (NDR85_02210) yclP 435912..436670 (+) 759 WP_263870874.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=697521 NDR85_RS02180 WP_010333023.1 431549..431671(+) (phrC) [Bacillus halotolerans strain XE48]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=697521 NDR85_RS02180 WP_010333023.1 431549..431671(+) (phrC) [Bacillus halotolerans strain XE48]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9