Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EFK13_RS02325 Genome accession   NZ_CP096889
Coordinates   457128..457250 (+) Length   40 a.a.
NCBI ID   WP_129506705.1    Uniprot ID   -
Organism   Bacillus cabrialesii strain TE3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 452128..462250
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EFK13_RS02310 (EFK13_02310) yclJ 453748..454431 (+) 684 WP_129506707.1 two-component system response regulator YclJ -
  EFK13_RS02315 (EFK13_02315) - 454418..455833 (+) 1416 WP_129506706.1 HAMP domain-containing sensor histidine kinase -
  EFK13_RS02320 (EFK13_02320) rapC 455996..457144 (+) 1149 WP_064814577.1 response regulator aspartate phosphatase RapC Regulator
  EFK13_RS02325 (EFK13_02325) phrC 457128..457250 (+) 123 WP_129506705.1 phosphatase RapC inhibitor PhrC Regulator
  EFK13_RS02330 (EFK13_02330) - 457349..457438 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EFK13_RS02335 (EFK13_02335) - 457593..457703 (-) 111 WP_129506704.1 YjcZ family sporulation protein -
  EFK13_RS02340 (EFK13_02340) - 457857..459221 (-) 1365 WP_129506703.1 aspartate kinase -
  EFK13_RS02345 (EFK13_02345) ceuB 459607..460557 (+) 951 WP_129506702.1 petrobactin ABC transporter permease YclN Machinery gene
  EFK13_RS02350 (EFK13_02350) yclO 460550..461497 (+) 948 WP_129506701.1 petrobactin ABC transporter permease YclO -
  EFK13_RS02355 (EFK13_02355) yclP 461491..462249 (+) 759 WP_129506700.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4228.01 Da        Isoelectric Point: 8.0285

>NTDB_id=684848 EFK13_RS02325 WP_129506705.1 457128..457250(+) (phrC) [Bacillus cabrialesii strain TE3]
MKLKSKLFVICLAAAAIFTATGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=684848 EFK13_RS02325 WP_129506705.1 457128..457250(+) (phrC) [Bacillus cabrialesii strain TE3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTCACAGCGACAGGCGTTTCCGCTAATGC
CGAAGCACTCGACTTTCATGTAACTGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975