Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | XCQ_RS16470 | Genome accession | NZ_CP096227 |
| Coordinates | 3811051..3811170 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain CQ13 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3790306..3810822 | 3811051..3811170 | flank | 229 |
Gene organization within MGE regions
Location: 3790306..3811170
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| XCQ_RS16395 (XCQ_16395) | - | 3790306..3791473 (+) | 1168 | Protein_3208 | IS3 family transposase | - |
| XCQ_RS16400 (XCQ_16400) | avrXacE2 | 3792233..3793303 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| XCQ_RS16405 (XCQ_16405) | - | 3793388..3794665 (-) | 1278 | WP_190416505.1 | lytic murein transglycosylase | - |
| XCQ_RS16410 (XCQ_16410) | - | 3794798..3797788 (-) | 2991 | WP_011052967.1 | Tn3-like element TnXax1 family transposase | - |
| XCQ_RS16415 (XCQ_16415) | - | 3797796..3799070 (-) | 1275 | Protein_3212 | site-specific integrase | - |
| XCQ_RS16420 (XCQ_16420) | - | 3799263..3800339 (+) | 1077 | WP_011052118.1 | DNA-binding protein | - |
| XCQ_RS16425 (XCQ_16425) | xopAI | 3800473..3801363 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| XCQ_RS16430 (XCQ_16430) | - | 3802694..3802978 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| XCQ_RS16435 (XCQ_16435) | - | 3803206..3804321 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| XCQ_RS16440 (XCQ_16440) | - | 3804276..3804791 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| XCQ_RS16445 (XCQ_16445) | sucD | 3804878..3805753 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| XCQ_RS16450 (XCQ_16450) | sucC | 3805778..3806947 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| XCQ_RS16455 (XCQ_16455) | - | 3807179..3808792 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| XCQ_RS16460 (XCQ_16460) | pilR | 3809117..3810511 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| XCQ_RS16465 (XCQ_16465) | - | 3810752..3810919 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| XCQ_RS16470 (XCQ_16470) | pilB | 3811051..3811170 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=680575 XCQ_RS16470 WP_005915819.1 3811051..3811170(-) (pilB) [Xanthomonas citri pv. citri strain CQ13]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=680575 XCQ_RS16470 WP_005915819.1 3811051..3811170(-) (pilB) [Xanthomonas citri pv. citri strain CQ13]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |