Detailed information    

insolico Bioinformatically predicted

Overview

Name   dinR/lexA   Type   Regulator
Locus tag   OG430_RS23420 Genome accession   NZ_CP109055
Coordinates   5311304..5311432 (+) Length   42 a.a.
NCBI ID   WP_327354535.1    Uniprot ID   -
Organism   Streptomyces sp. NBC_01304     
Function   repressor of recA; repressor of dinR (predicted from homology)   
Homologous recombination

Genomic Context

Location: 5306304..5316432
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OG430_RS23385 (OG430_23400) - 5306673..5307605 (-) 933 WP_327354530.1 DUF5655 domain-containing protein -
  OG430_RS23390 (OG430_23405) - 5308384..5309475 (-) 1092 WP_327354531.1 alpha/beta hydrolase -
  OG430_RS23395 (OG430_23410) - 5309588..5310310 (+) 723 WP_327354532.1 TetR/AcrR family transcriptional regulator -
  OG430_RS23400 (OG430_23415) - 5310314..5310403 (+) 90 Protein_4655 GntR family transcriptional regulator -
  OG430_RS23405 (OG430_23420) - 5310400..5310556 (+) 157 Protein_4656 YdcF family protein -
  OG430_RS23410 (OG430_23425) - 5310707..5310883 (-) 177 WP_327354533.1 hypothetical protein -
  OG430_RS23415 (OG430_23430) - 5311080..5311298 (+) 219 WP_327354534.1 hypothetical protein -
  OG430_RS23420 (OG430_23435) dinR/lexA 5311304..5311432 (+) 129 WP_327354535.1 hypothetical protein Regulator
  OG430_RS23425 (OG430_23440) - 5311377..5311889 (+) 513 WP_327354536.1 TetR family transcriptional regulator C-terminal domain-containing protein -
  OG430_RS23430 (OG430_23445) - 5311899..5312594 (+) 696 Protein_4661 response regulator transcription factor -
  OG430_RS23435 (OG430_23450) - 5312636..5313490 (-) 855 WP_327354537.1 inositol monophosphatase family protein -
  OG430_RS23440 (OG430_23455) - 5313513..5313953 (-) 441 WP_327359192.1 VTT domain-containing protein -
  OG430_RS23445 (OG430_23460) - 5313963..5314436 (+) 474 WP_327354538.1 hypothetical protein -
  OG430_RS23450 (OG430_23465) - 5314541..5314936 (+) 396 WP_327354539.1 helix-turn-helix transcriptional regulator -
  OG430_RS23455 (OG430_23470) modA 5315109..5315921 (+) 813 WP_327359193.1 molybdate ABC transporter substrate-binding protein -

Sequence

Protein


Download         Length: 42 a.a.        Molecular weight: 4513.12 Da        Isoelectric Point: 9.5972

>NTDB_id=670326 OG430_RS23420 WP_327354535.1 5311304..5311432(+) (dinR/lexA) [Streptomyces sp. NBC_01304]
MGGDELSDRQVRILRVIRVRIAEHGEAPTAREIGARVGPGSS

Nucleotide


Download         Length: 129 bp        

>NTDB_id=670326 OG430_RS23420 WP_327354535.1 5311304..5311432(+) (dinR/lexA) [Streptomyces sp. NBC_01304]
ATGGGTGGGGATGAGCTCAGCGATCGGCAGGTGCGCATCCTGCGAGTGATCCGGGTGCGGATCGCTGAGCACGGTGAAGC
CCCCACGGCCCGGGAGATCGGCGCGAGGGTCGGCCCCGGATCGTCGTAG

Domains

Predicted by InterProScan.

LexA DNA binding domain (LexA_DNA_bind)

(5-39)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  dinR/lexA Bacillus subtilis subsp. subtilis str. 168

47.368

90.476

0.429