Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   LK685_RS19545 Genome accession   NZ_CP086061
Coordinates   3739439..3739561 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. BC1-43     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3734439..3744561
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LK685_RS19515 (LK685_19520) yclP 3734512..3735270 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  LK685_RS19520 (LK685_19525) yclO 3735264..3736211 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  LK685_RS19525 (LK685_19530) ceuB 3736204..3737154 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  LK685_RS19530 (LK685_19535) - 3737538..3738902 (+) 1365 WP_229762521.1 aspartate kinase -
  LK685_RS19535 (LK685_19540) - 3739055..3739168 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  LK685_RS19540 (LK685_19545) - 3739250..3739339 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  LK685_RS19545 (LK685_19550) phrC 3739439..3739561 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  LK685_RS19550 (LK685_19555) rapC 3739545..3740693 (-) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  LK685_RS19555 (LK685_19560) yclK 3740856..3742277 (-) 1422 WP_229762522.1 two-component system sensor histidine kinase YclK -
  LK685_RS19560 (LK685_19565) yclJ 3742264..3742947 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=622211 LK685_RS19545 WP_003224994.1 3739439..3739561(-) (phrC) [Bacillus sp. BC1-43]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=622211 LK685_RS19545 WP_003224994.1 3739439..3739561(-) (phrC) [Bacillus sp. BC1-43]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1