Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | KJA71_RS16880 | Genome accession | NZ_CP075325 |
| Coordinates | 3868276..3868395 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain GD82 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3847187..3868047 | 3868276..3868395 | flank | 229 |
Gene organization within MGE regions
Location: 3847187..3868395
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KJA71_RS16800 (KJA71_16800) | - | 3847187..3847534 (-) | 348 | WP_040107789.1 | endonuclease domain-containing protein | - |
| KJA71_RS16805 (KJA71_16805) | - | 3847572..3848739 (+) | 1168 | Protein_3299 | IS3 family transposase | - |
| KJA71_RS16810 (KJA71_16810) | avrXacE2 | 3849499..3850569 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| KJA71_RS16815 (KJA71_16815) | - | 3850654..3851931 (-) | 1278 | WP_190416505.1 | lytic murein transglycosylase | - |
| KJA71_RS16820 (KJA71_16820) | - | 3852064..3855054 (-) | 2991 | WP_011052967.1 | Tn3-like element TnXax1 family transposase | - |
| KJA71_RS16825 (KJA71_16825) | - | 3855062..3856336 (-) | 1275 | WP_011052968.1 | tyrosine-type recombinase/integrase | - |
| KJA71_RS16830 (KJA71_16830) | - | 3856528..3857583 (+) | 1056 | WP_191589630.1 | DNA-binding protein | - |
| KJA71_RS16835 (KJA71_16835) | xopAI | 3857716..3858606 (+) | 891 | WP_217377102.1 | type III secretion system effector XopAI | - |
| KJA71_RS16840 (KJA71_16840) | - | 3859937..3860221 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| KJA71_RS16845 (KJA71_16845) | - | 3860449..3861564 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| KJA71_RS16850 (KJA71_16850) | - | 3861519..3862034 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| KJA71_RS16855 (KJA71_16855) | sucD | 3862121..3862996 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| KJA71_RS16860 (KJA71_16860) | sucC | 3863021..3864190 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| KJA71_RS16865 (KJA71_16865) | - | 3864422..3866035 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| KJA71_RS16870 (KJA71_16870) | pilR | 3866360..3867754 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| KJA71_RS16875 (KJA71_16875) | - | 3867977..3868144 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| KJA71_RS16880 (KJA71_16880) | pilB | 3868276..3868395 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=568806 KJA71_RS16880 WP_005915819.1 3868276..3868395(-) (pilB) [Xanthomonas citri pv. citri strain GD82]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=568806 KJA71_RS16880 WP_005915819.1 3868276..3868395(-) (pilB) [Xanthomonas citri pv. citri strain GD82]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |