Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   JS609_RS02160 Genome accession   NZ_CP071043
Coordinates   424779..424901 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate ELA2001105     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 419779..429901
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JS609_RS02145 (JS609_00420) yclJ 421393..422076 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  JS609_RS02150 (JS609_00421) yclK 422063..423484 (+) 1422 WP_213414881.1 sensor histidine kinase -
  JS609_RS02155 (JS609_00422) rapC 423647..424795 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  JS609_RS02160 (JS609_00423) phrC 424779..424901 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  JS609_RS02165 (JS609_00424) yczM 425001..425090 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  JS609_RS02170 (JS609_00425) yczN 425172..425285 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  JS609_RS02175 (JS609_00426) thrD 425439..426803 (-) 1365 WP_033883679.1 aspartate kinase -
  JS609_RS02180 (JS609_00427) ceuB 427188..428138 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  JS609_RS02185 (JS609_00428) yclO 428131..429078 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  JS609_RS02190 (JS609_00429) yclP 429072..429830 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=542485 JS609_RS02160 WP_003224994.1 424779..424901(+) (phrC) [Bacillus subtilis isolate ELA2001105]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=542485 JS609_RS02160 WP_003224994.1 424779..424901(+) (phrC) [Bacillus subtilis isolate ELA2001105]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1