Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   JYG31_RS13300 Genome accession   NZ_CP070976
Coordinates   2584010..2584183 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain MBH1     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2579010..2589183
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JYG31_RS13285 (JYG31_13285) gcvT 2579808..2580896 (-) 1089 WP_213417733.1 glycine cleavage system aminomethyltransferase GcvT -
  JYG31_RS13290 (JYG31_13290) - 2581339..2583012 (+) 1674 WP_213417734.1 SNF2-related protein -
  JYG31_RS13295 (JYG31_13295) - 2583032..2583826 (+) 795 WP_024122035.1 YqhG family protein -
  JYG31_RS13300 (JYG31_13300) sinI 2584010..2584183 (+) 174 WP_024122036.1 anti-repressor SinI family protein Regulator
  JYG31_RS13305 (JYG31_13305) sinR 2584217..2584552 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  JYG31_RS13310 (JYG31_13310) tasA 2584639..2585424 (-) 786 WP_095713270.1 biofilm matrix protein TasA -
  JYG31_RS13315 (JYG31_13315) - 2585489..2586073 (-) 585 WP_213417735.1 signal peptidase I -
  JYG31_RS13320 (JYG31_13320) tapA 2586045..2586806 (-) 762 WP_213417736.1 amyloid fiber anchoring/assembly protein TapA -
  JYG31_RS13325 (JYG31_13325) - 2587084..2587407 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  JYG31_RS13330 (JYG31_13330) - 2587450..2587629 (-) 180 WP_003236949.1 YqzE family protein -
  JYG31_RS13335 (JYG31_13335) comGG 2587701..2588075 (-) 375 WP_188323133.1 competence type IV pilus minor pilin ComGG Machinery gene
  JYG31_RS13340 (JYG31_13340) comGF 2588076..2588465 (-) 390 WP_213417737.1 competence type IV pilus minor pilin ComGF Machinery gene
  JYG31_RS13345 (JYG31_13345) comGE 2588491..2588838 (-) 348 WP_095713273.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=541736 JYG31_RS13300 WP_024122036.1 2584010..2584183(+) (sinI) [Bacillus halotolerans strain MBH1]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=541736 JYG31_RS13300 WP_024122036.1 2584010..2584183(+) (sinI) [Bacillus halotolerans strain MBH1]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947