Detailed information
Overview
| Name | pilL-C | Type | Machinery gene |
| Locus tag | JWH23_RS31375 | Genome accession | NZ_CP070896 |
| Coordinates | 1740169..1740255 (-) | Length | 28 a.a. |
| NCBI ID | WP_349773192.1 | Uniprot ID | - |
| Organism | Lacrimispora xylanisolvens strain ASCUSBR21 | ||
| Function | type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1735169..1745255
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| JWH23_RS09670 | - | 1735433..1735660 (+) | 228 | WP_277408937.1 | DUF6774 domain-containing protein | - |
| JWH23_RS31360 | holA | 1735717..1736202 (-) | 486 | WP_349773004.1 | DNA polymerase III subunit delta | - |
| JWH23_RS31365 | - | 1736204..1736473 (-) | 270 | WP_349773005.1 | hypothetical protein | - |
| JWH23_RS31370 | - | 1736470..1736700 (-) | 231 | WP_349773006.1 | hypothetical protein | - |
| JWH23_RS09680 | - | 1736697..1737200 (-) | 504 | WP_277408938.1 | hypothetical protein | - |
| JWH23_RS09685 | - | 1737250..1737921 (-) | 672 | WP_277408939.1 | MBL fold metallo-hydrolase | - |
| JWH23_RS09690 | - | 1737812..1738663 (-) | 852 | WP_277408940.1 | ComEC/Rec2 family competence protein | - |
| JWH23_RS09695 | - | 1738608..1739102 (-) | 495 | WP_277408941.1 | ComEC/Rec2 family competence protein | - |
| JWH23_RS09700 | - | 1739165..1740151 (-) | 987 | WP_104436732.1 | GerMN domain-containing protein | - |
| JWH23_RS31375 | pilL-C | 1740169..1740255 (-) | 87 | WP_349773192.1 | hypothetical protein | Machinery gene |
| JWH23_RS09705 | - | 1740365..1741462 (-) | 1098 | Protein_2028 | HAMP domain-containing sensor histidine kinase | - |
| JWH23_RS09710 | - | 1741641..1742507 (-) | 867 | WP_277408942.1 | DegV family protein | - |
| JWH23_RS09715 | - | 1742532..1744302 (-) | 1771 | Protein_2030 | ABC transporter ATP-binding protein | - |
Sequence
Protein
Download Length: 28 a.a. Molecular weight: 3106.59 Da Isoelectric Point: 8.7434
>NTDB_id=541288 JWH23_RS31375 WP_349773192.1 1740169..1740255(-) (pilL-C) [Lacrimispora xylanisolvens strain ASCUSBR21]
MHQGAIKLQSKEGEGTTFTVRIPLTYIS
MHQGAIKLQSKEGEGTTFTVRIPLTYIS
Nucleotide
Download Length: 87 bp
>NTDB_id=541288 JWH23_RS31375 WP_349773192.1 1740169..1740255(-) (pilL-C) [Lacrimispora xylanisolvens strain ASCUSBR21]
ATGCATCAGGGAGCGATCAAGCTTCAGAGCAAAGAGGGAGAGGGTACTACATTTACTGTACGTATTCCTCTTACATACAT
TTCTTAG
ATGCATCAGGGAGCGATCAAGCTTCAGAGCAAAGAGGGAGAGGGTACTACATTTACTGTACGTATTCCTCTTACATACAT
TTCTTAG
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilL-C | Synechocystis sp. PCC 6803 |
60.87 |
82.143 |
0.5 |
| vicK | Streptococcus mutans UA159 |
54.545 |
78.571 |
0.429 |
| chpA | Acinetobacter baumannii strain A118 |
50 |
78.571 |
0.393 |