Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   JQ490_RS11050 Genome accession   NZ_CP069378
Coordinates   2236228..2236524 (+) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis subsp. lactis bv. diacetylactis strain Ge001     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2231228..2241524
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JQ490_RS11030 (JQ490_11030) comGA 2233563..2234501 (+) 939 WP_010906320.1 competence type IV pilus ATPase ComGA Machinery gene
  JQ490_RS11035 (JQ490_11035) comGB 2234395..2235468 (+) 1074 WP_010906319.1 competence type IV pilus assembly protein ComGB Machinery gene
  JQ490_RS11040 (JQ490_11040) comGC 2235596..2235865 (+) 270 WP_023349160.1 competence type IV pilus major pilin ComGC Machinery gene
  JQ490_RS11045 (JQ490_11045) comGD 2235840..2236256 (+) 417 WP_021216554.1 competence type IV pilus minor pilin ComGD Machinery gene
  JQ490_RS11050 (JQ490_11050) comGE 2236228..2236524 (+) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  JQ490_RS11055 (JQ490_11055) comGF 2236487..2236933 (+) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  JQ490_RS11060 (JQ490_11060) comGG 2236972..2237256 (+) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  JQ490_RS11065 (JQ490_11065) - 2237337..2237774 (+) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  JQ490_RS11070 (JQ490_11070) - 2237771..2238613 (+) 843 WP_010906312.1 metal ABC transporter substrate-binding protein -
  JQ490_RS11075 (JQ490_11075) - 2238790..2239527 (+) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  JQ490_RS11080 (JQ490_11080) - 2239520..2240329 (+) 810 WP_010906310.1 metal ABC transporter permease -
  JQ490_RS11085 (JQ490_11085) - 2240368..2241234 (-) 867 WP_010906309.1 RluA family pseudouridine synthase -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=534244 JQ490_RS11050 WP_010906316.1 2236228..2236524(+) (comGE) [Lactococcus lactis subsp. lactis bv. diacetylactis strain Ge001]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=534244 JQ490_RS11050 WP_010906316.1 2236228..2236524(+) (comGE) [Lactococcus lactis subsp. lactis bv. diacetylactis strain Ge001]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673