Detailed information
Bioinformatically predicted
Overview
| Name | comC/blpC | Type | Regulator |
| Locus tag | SMUGS5_RS08585 | Genome accession | NC_018089 |
| Coordinates | 1776174..1776314 (+) | Length | 46 a.a. |
| NCBI ID | WP_002267610.1 | Uniprot ID | Q99QI5 |
| Organism | Streptococcus mutans GS-5 | ||
| Function | binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology) Competence regulation |
||
Genomic Context
Location: 1771174..1781314
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SMUGS5_RS08560 (SMUGS5_08510) | - | 1771239..1771451 (-) | 213 | WP_002263744.1 | Blp family class II bacteriocin | - |
| SMUGS5_RS10230 (SMUGS5_08515) | - | 1771856..1772020 (-) | 165 | WP_002265308.1 | hypothetical protein | - |
| SMUGS5_RS10690 | - | 1772460..1772672 (+) | 213 | Protein_1664 | IS3 family transposase | - |
| SMUGS5_RS08570 (SMUGS5_08525) | - | 1772795..1773199 (-) | 405 | WP_002274065.1 | hypothetical protein | - |
| SMUGS5_RS08575 (SMUGS5_08530) | - | 1773346..1773765 (-) | 420 | WP_002263913.1 | hypothetical protein | - |
| SMUGS5_RS08580 (SMUGS5_08535) | - | 1775146..1775547 (-) | 402 | WP_002310604.1 | hypothetical protein | - |
| SMUGS5_RS10505 | - | 1775678..1775907 (-) | 230 | Protein_1668 | Blp family class II bacteriocin | - |
| SMUGS5_RS08585 (SMUGS5_08550) | comC/blpC | 1776174..1776314 (+) | 141 | WP_002267610.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | Regulator |
| SMUGS5_RS08590 (SMUGS5_08555) | comD/blpH | 1776456..1777781 (-) | 1326 | WP_014835041.1 | sensor histidine kinase | Regulator |
| SMUGS5_RS08595 (SMUGS5_08560) | comE/blpR | 1777778..1778530 (-) | 753 | WP_002270252.1 | response regulator transcription factor | Regulator |
| SMUGS5_RS08600 (SMUGS5_08565) | - | 1779001..1779639 (-) | 639 | WP_002271525.1 | VTT domain-containing protein | - |
| SMUGS5_RS08605 (SMUGS5_08570) | - | 1779687..1780313 (-) | 627 | WP_002265453.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 46 a.a. Molecular weight: 5211.06 Da Isoelectric Point: 10.4929
>NTDB_id=52052 SMUGS5_RS08585 WP_002267610.1 1776174..1776314(+) (comC/blpC) [Streptococcus mutans GS-5]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
Nucleotide
Download Length: 141 bp
>NTDB_id=52052 SMUGS5_RS08585 WP_002267610.1 1776174..1776314(+) (comC/blpC) [Streptococcus mutans GS-5]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comC/blpC | Streptococcus mutans UA159 |
100 |
100 |
1 |