Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   IMZ18_RS16360 Genome accession   NZ_CP063151
Coordinates   3048915..3049037 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain CMIN-4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3043915..3054037
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IMZ18_RS16330 (IMZ18_16330) yclP 3043983..3044741 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  IMZ18_RS16335 (IMZ18_16335) yclO 3044735..3045682 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  IMZ18_RS16340 (IMZ18_16340) ceuB 3045675..3046625 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  IMZ18_RS16345 (IMZ18_16345) thrD 3047015..3048379 (+) 1365 WP_014478832.1 aspartate kinase -
  IMZ18_RS16350 (IMZ18_16350) yczN 3048532..3048645 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  IMZ18_RS16355 (IMZ18_16355) yczM 3048727..3048816 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  IMZ18_RS16360 (IMZ18_16360) phrC 3048915..3049037 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IMZ18_RS16365 (IMZ18_16365) rapC 3049021..3050169 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  IMZ18_RS16370 (IMZ18_16370) yclK 3050332..3051753 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  IMZ18_RS16375 (IMZ18_16375) yclJ 3051740..3052423 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=493492 IMZ18_RS16360 WP_003224994.1 3048915..3049037(-) (phrC) [Bacillus subtilis subsp. subtilis strain CMIN-4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=493492 IMZ18_RS16360 WP_003224994.1 3048915..3049037(-) (phrC) [Bacillus subtilis subsp. subtilis strain CMIN-4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1