Detailed information    

insolico Bioinformatically predicted

Overview

Name   pilB   Type   Machinery gene
Locus tag   IG630_RS16885 Genome accession   NZ_CP062255
Coordinates   3846262..3846381 (-) Length   39 a.a.
NCBI ID   WP_005915819.1    Uniprot ID   A0A7S6YV99
Organism   Xanthomonas sp. WG16     
Function   power the assembly of type IV pilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 3822206..3871252 3846262..3846381 within 0


Gene organization within MGE regions


Location: 3822206..3871252
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IG630_RS16790 (IG630_16425) - 3822514..3823491 (+) 978 WP_015463514.1 hypothetical protein -
  IG630_RS16795 (IG630_16430) - 3823510..3825150 (-) 1641 WP_005930977.1 NAD+ synthase -
  IG630_RS16800 (IG630_16435) - 3825173..3825520 (-) 348 WP_040107789.1 endonuclease domain-containing protein -
  IG630_RS16805 (IG630_16440) - 3825558..3826725 (+) 1168 Protein_3283 IS3 family transposase -
  IG630_RS16810 (IG630_16445) avrXacE2 3827485..3828555 (-) 1071 WP_011052114.1 type III secretion system effector avirulence protein AvrXacE2 -
  IG630_RS16815 (IG630_16450) - 3828640..3829917 (-) 1278 WP_190416505.1 lytic murein transglycosylase -
  IG630_RS16820 (IG630_16455) - 3830050..3833040 (-) 2991 WP_011052967.1 Tn3-like element TnXax1 family transposase -
  IG630_RS16825 (IG630_16460) - 3833048..3834322 (-) 1275 WP_011052968.1 tyrosine-type recombinase/integrase -
  IG630_RS16830 (IG630_16465) - 3834514..3835569 (+) 1056 WP_223293134.1 DNA-binding protein -
  IG630_RS16835 (IG630_16470) xopAI 3835702..3836592 (+) 891 WP_217377102.1 type III secretion system effector XopAI -
  IG630_RS16840 (IG630_24365) - 3837012..3837818 (-) 807 WP_015463520.1 hypothetical protein -
  IG630_RS16845 (IG630_16475) - 3837923..3838207 (+) 285 WP_016849322.1 hypothetical protein -
  IG630_RS16850 (IG630_16480) - 3838435..3839550 (+) 1116 WP_011052122.1 IS1595 family transposase -
  IG630_RS16855 (IG630_16485) - 3839505..3840020 (-) 516 WP_011052123.1 hypothetical protein -
  IG630_RS16860 (IG630_16490) sucD 3840107..3840982 (-) 876 WP_005921370.1 succinate--CoA ligase subunit alpha -
  IG630_RS16865 (IG630_16495) sucC 3841007..3842176 (-) 1170 WP_005915812.1 ADP-forming succinate--CoA ligase subunit beta -
  IG630_RS16870 (IG630_16500) - 3842408..3844021 (+) 1614 WP_003488599.1 HAMP domain-containing sensor histidine kinase -
  IG630_RS16875 (IG630_16505) pilR 3844346..3845740 (+) 1395 WP_015463522.1 sigma-54 dependent transcriptional regulator Regulator
  IG630_RS16880 (IG630_16510) - 3845963..3846130 (-) 168 WP_015463523.1 hypothetical protein -
  IG630_RS16885 (IG630_16515) pilB 3846262..3846381 (-) 120 WP_005915819.1 hypothetical protein Machinery gene
  IG630_RS16890 (IG630_16520) pilB 3846875..3848611 (-) 1737 WP_011052125.1 type IV-A pilus assembly ATPase PilB Machinery gene
  IG630_RS16895 (IG630_16525) - 3848675..3849130 (-) 456 WP_015463526.1 pilin -
  IG630_RS16900 (IG630_16530) - 3849240..3849680 (-) 441 WP_011052127.1 pilin -
  IG630_RS16905 (IG630_16535) pilC 3850036..3851292 (+) 1257 WP_040107659.1 type II secretion system F family protein Machinery gene
  IG630_RS16910 (IG630_16540) - 3851299..3852162 (+) 864 WP_003491180.1 A24 family peptidase -
  IG630_RS16915 (IG630_16545) coaE 3852176..3852784 (+) 609 WP_011052129.1 dephospho-CoA kinase -
  IG630_RS16920 (IG630_16550) - 3853008..3857531 (+) 4524 WP_040107660.1 RHS repeat-associated core domain-containing protein -
  IG630_RS16925 (IG630_16555) - 3858166..3858531 (+) 366 WP_075150055.1 SymE family type I addiction module toxin -
  IG630_RS16930 (IG630_16560) - 3858545..3859689 (+) 1145 WP_087943921.1 IS3-like element ISXac3 family transposase -
  IG630_RS16935 (IG630_16565) - 3859715..3859801 (+) 87 Protein_3309 SymE family type I addiction module toxin -
  IG630_RS16940 (IG630_16570) - 3859904..3861238 (-) 1335 WP_003490680.1 HAMP domain-containing sensor histidine kinase -
  IG630_RS16945 (IG630_16575) - 3861231..3861908 (-) 678 WP_003490678.1 response regulator transcription factor -
  IG630_RS16950 (IG630_16580) - 3861934..3862410 (-) 477 WP_011052133.1 hypothetical protein -
  IG630_RS16955 (IG630_16585) rimK 3862588..3863504 (-) 917 Protein_3313 30S ribosomal protein S6--L-glutamate ligase -
  IG630_RS16960 (IG630_16590) glgX 3863968..3866100 (+) 2133 WP_011052136.1 glycogen debranching protein GlgX -
  IG630_RS16965 (IG630_16595) - 3866730..3867122 (-) 393 WP_003490669.1 H-NS family nucleoid-associated regulatory protein -
  IG630_RS16970 (IG630_16600) - 3867213..3867605 (-) 393 WP_003490667.1 hypothetical protein -
  IG630_RS16975 (IG630_16605) - 3867716..3868375 (-) 660 WP_015463531.1 thermonuclease family protein -
  IG630_RS16980 (IG630_16610) - 3869275..3869637 (+) 363 WP_015463532.1 hypothetical protein -

Sequence

Protein


Download         Length: 39 a.a.        Molecular weight: 4178.84 Da        Isoelectric Point: 9.0113

>NTDB_id=487443 IG630_RS16885 WP_005915819.1 3846262..3846381(-) (pilB) [Xanthomonas sp. WG16]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide


Download         Length: 120 bp        

>NTDB_id=487443 IG630_RS16885 WP_005915819.1 3846262..3846381(-) (pilB) [Xanthomonas sp. WG16]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA

Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A7S6YV99

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  pilB Acinetobacter baylyi ADP1

51.282

100

0.513
  pilB Acinetobacter baumannii D1279779

48.718

100

0.487
  pilB Vibrio cholerae strain A1552

45.714

89.744

0.41
  pilB Legionella pneumophila strain ERS1305867

38.462

100

0.385