Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   ICJ61_RS12865 Genome accession   NZ_CP061284
Coordinates   2497122..2497298 (+) Length   58 a.a.
NCBI ID   WP_188323132.1    Uniprot ID   -
Organism   Bacillus halotolerans strain XH-1     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2492122..2502298
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ICJ61_RS12850 (ICJ61_12850) gcvT 2492919..2494007 (-) 1089 WP_188323131.1 glycine cleavage system aminomethyltransferase GcvT -
  ICJ61_RS12855 (ICJ61_12855) - 2494451..2496124 (+) 1674 WP_127696774.1 DEAD/DEAH box helicase -
  ICJ61_RS12860 (ICJ61_12860) - 2496144..2496938 (+) 795 WP_127696773.1 YqhG family protein -
  ICJ61_RS12865 (ICJ61_12865) sinI 2497122..2497298 (+) 177 WP_188323132.1 anti-repressor SinI Regulator
  ICJ61_RS12870 (ICJ61_12870) sinR 2497332..2497667 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  ICJ61_RS12875 (ICJ61_12875) tasA 2497754..2498539 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  ICJ61_RS12880 (ICJ61_12880) sipW 2498604..2499188 (-) 585 WP_105955579.1 signal peptidase I SipW -
  ICJ61_RS12885 (ICJ61_12885) tapA 2499160..2499921 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  ICJ61_RS12890 (ICJ61_12890) - 2500189..2500512 (+) 324 WP_101864527.1 YqzG/YhdC family protein -
  ICJ61_RS12895 (ICJ61_12895) - 2500555..2500734 (-) 180 WP_003236949.1 YqzE family protein -
  ICJ61_RS12900 (ICJ61_12900) comGG 2500806..2501180 (-) 375 WP_188323133.1 competence type IV pilus minor pilin ComGG Machinery gene
  ICJ61_RS12905 (ICJ61_12905) comGF 2501181..2501600 (-) 420 WP_316961080.1 competence type IV pilus minor pilin ComGF Machinery gene
  ICJ61_RS12910 (ICJ61_12910) comGE 2501590..2501937 (-) 348 WP_151175142.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 58 a.a.        Molecular weight: 6762.70 Da        Isoelectric Point: 6.7231

>NTDB_id=481526 ICJ61_RS12865 WP_188323132.1 2497122..2497298(+) (sinI) [Bacillus halotolerans strain XH-1]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRSKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 177 bp        

>NTDB_id=481526 ICJ61_RS12865 WP_188323132.1 2497122..2497298(+) (sinI) [Bacillus halotolerans strain XH-1]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATA
CCATAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-34)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

93.103

100

0.931