Detailed information
Overview
| Name | sinI | Type | Regulator |
| Locus tag | ICJ61_RS12865 | Genome accession | NZ_CP061284 |
| Coordinates | 2497122..2497298 (+) | Length | 58 a.a. |
| NCBI ID | WP_188323132.1 | Uniprot ID | - |
| Organism | Bacillus halotolerans strain XH-1 | ||
| Function | inhibit the expression of sinR (predicted from homology) Competence regulation |
||
Genomic Context
Location: 2492122..2502298
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ICJ61_RS12850 (ICJ61_12850) | gcvT | 2492919..2494007 (-) | 1089 | WP_188323131.1 | glycine cleavage system aminomethyltransferase GcvT | - |
| ICJ61_RS12855 (ICJ61_12855) | - | 2494451..2496124 (+) | 1674 | WP_127696774.1 | DEAD/DEAH box helicase | - |
| ICJ61_RS12860 (ICJ61_12860) | - | 2496144..2496938 (+) | 795 | WP_127696773.1 | YqhG family protein | - |
| ICJ61_RS12865 (ICJ61_12865) | sinI | 2497122..2497298 (+) | 177 | WP_188323132.1 | anti-repressor SinI | Regulator |
| ICJ61_RS12870 (ICJ61_12870) | sinR | 2497332..2497667 (+) | 336 | WP_003226345.1 | transcriptional regulator SinR | Regulator |
| ICJ61_RS12875 (ICJ61_12875) | tasA | 2497754..2498539 (-) | 786 | WP_106020091.1 | biofilm matrix protein TasA | - |
| ICJ61_RS12880 (ICJ61_12880) | sipW | 2498604..2499188 (-) | 585 | WP_105955579.1 | signal peptidase I SipW | - |
| ICJ61_RS12885 (ICJ61_12885) | tapA | 2499160..2499921 (-) | 762 | WP_106020093.1 | amyloid fiber anchoring/assembly protein TapA | - |
| ICJ61_RS12890 (ICJ61_12890) | - | 2500189..2500512 (+) | 324 | WP_101864527.1 | YqzG/YhdC family protein | - |
| ICJ61_RS12895 (ICJ61_12895) | - | 2500555..2500734 (-) | 180 | WP_003236949.1 | YqzE family protein | - |
| ICJ61_RS12900 (ICJ61_12900) | comGG | 2500806..2501180 (-) | 375 | WP_188323133.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| ICJ61_RS12905 (ICJ61_12905) | comGF | 2501181..2501600 (-) | 420 | WP_316961080.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| ICJ61_RS12910 (ICJ61_12910) | comGE | 2501590..2501937 (-) | 348 | WP_151175142.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 58 a.a. Molecular weight: 6762.70 Da Isoelectric Point: 6.7231
>NTDB_id=481526 ICJ61_RS12865 WP_188323132.1 2497122..2497298(+) (sinI) [Bacillus halotolerans strain XH-1]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRSKYLLLNKKSAHPGPAARSHTINPF
MKNAKQEHFELDQEWVELMMEAREANISPEEIRSKYLLLNKKSAHPGPAARSHTINPF
Nucleotide
Download Length: 177 bp
>NTDB_id=481526 ICJ61_RS12865 WP_188323132.1 2497122..2497298(+) (sinI) [Bacillus halotolerans strain XH-1]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATA
CCATAAATCCTTTCTGA
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATA
CCATAAATCCTTTCTGA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| sinI | Bacillus subtilis subsp. subtilis str. 168 |
93.103 |
100 |
0.931 |