Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   H8S71_RS02160 Genome accession   NZ_CP060417
Coordinates   429863..429985 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain ONU 559     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424863..434985
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  H8S71_RS02145 (H8S71_02140) yclJ 426476..427159 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  H8S71_RS02150 (H8S71_02145) yclK 427146..428567 (+) 1422 WP_187002058.1 two-component system sensor histidine kinase YclK -
  H8S71_RS02155 (H8S71_02150) rapC 428731..429879 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  H8S71_RS02160 (H8S71_02155) phrC 429863..429985 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  H8S71_RS02165 (H8S71_02160) yczM 430084..430173 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  H8S71_RS02170 (H8S71_02165) yczN 430255..430368 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  H8S71_RS02175 (H8S71_02170) thrD 430521..431885 (-) 1365 WP_187002059.1 aspartate kinase -
  H8S71_RS02180 (H8S71_02175) ceuB 432270..433220 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  H8S71_RS02185 (H8S71_02180) yclO 433213..434160 (+) 948 WP_125121454.1 petrobactin ABC transporter permease YclO -
  H8S71_RS02190 (H8S71_02185) yclP 434154..434912 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=475861 H8S71_RS02160 WP_003224994.1 429863..429985(+) (phrC) [Bacillus subtilis subsp. subtilis strain ONU 559]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=475861 H8S71_RS02160 WP_003224994.1 429863..429985(+) (phrC) [Bacillus subtilis subsp. subtilis strain ONU 559]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1