Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   H7F27_RS18815 Genome accession   NZ_CP060193
Coordinates   3713633..3713755 (-) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus sp. PAMC26543     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3708633..3718755
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  H7F27_RS18785 (H7F27_18785) yclP 3708636..3709394 (-) 759 WP_095714087.1 petrobactin ABC transporter ATP-binding protein YclP -
  H7F27_RS18790 (H7F27_18790) yclO 3709388..3710335 (-) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  H7F27_RS18795 (H7F27_18795) ceuB 3710328..3711278 (-) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  H7F27_RS18800 (H7F27_18800) - 3711664..3713028 (+) 1365 WP_185848283.1 aspartate kinase -
  H7F27_RS18805 (H7F27_18805) - 3713179..3713289 (+) 111 WP_024120215.1 YjcZ family sporulation protein -
  H7F27_RS18810 (H7F27_18810) - 3713436..3713528 (+) 93 WP_024120214.1 YjcZ family sporulation protein -
  H7F27_RS18815 (H7F27_18815) phrC 3713633..3713755 (-) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  H7F27_RS18820 (H7F27_18820) rapC 3713739..3714887 (-) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  H7F27_RS18825 (H7F27_18825) - 3715059..3716483 (-) 1425 WP_185848284.1 HAMP domain-containing sensor histidine kinase -
  H7F27_RS18830 (H7F27_18830) yclJ 3716470..3717153 (-) 684 WP_185848285.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=474538 H7F27_RS18815 WP_024120213.1 3713633..3713755(-) (phrC) [Bacillus sp. PAMC26543]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=474538 H7F27_RS18815 WP_024120213.1 3713633..3713755(-) (phrC) [Bacillus sp. PAMC26543]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875