Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   H7F27_RS08720 Genome accession   NZ_CP060193
Coordinates   1712516..1712689 (-) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus sp. PAMC26543     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 1707516..1717689
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  H7F27_RS08675 (H7F27_08675) comGE 1707869..1708216 (+) 348 WP_185848829.1 competence type IV pilus minor pilin ComGE Machinery gene
  H7F27_RS08680 (H7F27_08680) comGF 1708242..1708625 (+) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  H7F27_RS08685 (H7F27_08685) comGG 1708626..1709000 (+) 375 WP_185848830.1 competence type IV pilus minor pilin ComGG Machinery gene
  H7F27_RS08690 (H7F27_08690) - 1709072..1709251 (+) 180 WP_003236949.1 YqzE family protein -
  H7F27_RS08695 (H7F27_08695) - 1709293..1709616 (-) 324 WP_024122040.1 YqzG/YhdC family protein -
  H7F27_RS08700 (H7F27_08700) tapA 1709893..1710654 (+) 762 WP_185848831.1 amyloid fiber anchoring/assembly protein TapA -
  H7F27_RS08705 (H7F27_08705) sipW 1710626..1711210 (+) 585 WP_101861033.1 signal peptidase I SipW -
  H7F27_RS08710 (H7F27_08710) tasA 1711275..1712060 (+) 786 WP_024122037.1 biofilm matrix protein TasA -
  H7F27_RS08715 (H7F27_08715) sinR 1712147..1712482 (-) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  H7F27_RS08720 (H7F27_08720) sinI 1712516..1712689 (-) 174 WP_024122036.1 anti-repressor SinI Regulator
  H7F27_RS08725 (H7F27_08725) - 1712873..1713667 (-) 795 WP_185848832.1 YqhG family protein -
  H7F27_RS08730 (H7F27_08730) - 1713687..1715360 (-) 1674 WP_185848833.1 DEAD/DEAH box helicase -
  H7F27_RS08735 (H7F27_08735) gcvT 1715803..1716891 (+) 1089 WP_185848834.1 glycine cleavage system aminomethyltransferase GcvT -

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=474507 H7F27_RS08720 WP_024122036.1 1712516..1712689(-) (sinI) [Bacillus sp. PAMC26543]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=474507 H7F27_RS08720 WP_024122036.1 1712516..1712689(-) (sinI) [Bacillus sp. PAMC26543]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947