Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | HZS91_RS16635 | Genome accession | NZ_CP060002 |
| Coordinates | 3862012..3862131 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain SN3-3 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3843234..3861783 | 3862012..3862131 | flank | 229 |
Gene organization within MGE regions
Location: 3843234..3862131
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HZS91_RS16565 (HZS91_03500) | avrXacE2 | 3843234..3844304 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| HZS91_RS16570 (HZS91_03501) | - | 3844389..3845666 (-) | 1278 | WP_011052115.1 | lytic murein transglycosylase | - |
| HZS91_RS16575 (HZS91_03502) | - | 3845799..3848789 (-) | 2991 | WP_219875336.1 | Tn3 family transposase | - |
| HZS91_RS16580 (HZS91_03503) | - | 3848798..3850072 (-) | 1275 | Protein_3249 | site-specific integrase | - |
| HZS91_RS16585 (HZS91_03504) | - | 3850264..3851319 (+) | 1056 | WP_219875338.1 | DNA-binding protein | - |
| HZS91_RS16590 (HZS91_03505) | xopAI | 3851452..3852342 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| HZS91_RS16595 (HZS91_03507) | - | 3853673..3853957 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| HZS91_RS16600 (HZS91_03508) | - | 3854185..3855300 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| HZS91_RS16605 (HZS91_03509) | - | 3855255..3855770 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| HZS91_RS16610 (HZS91_03510) | sucD | 3855857..3856732 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| HZS91_RS16615 (HZS91_03511) | sucC | 3856757..3857926 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| HZS91_RS16620 (HZS91_03512) | - | 3858158..3859771 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| HZS91_RS16625 (HZS91_03513) | pilR | 3860096..3861490 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| HZS91_RS16630 (HZS91_03515) | - | 3861713..3861880 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| HZS91_RS16635 (HZS91_03516) | pilB | 3862012..3862131 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=473174 HZS91_RS16635 WP_005915819.1 3862012..3862131(-) (pilB) [Xanthomonas citri pv. citri strain SN3-3]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=473174 HZS91_RS16635 WP_005915819.1 3862012..3862131(-) (pilB) [Xanthomonas citri pv. citri strain SN3-3]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |