Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | HZS93_RS16595 | Genome accession | NZ_CP059992 |
| Coordinates | 3838804..3838923 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri strain T4 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3815449..3838575 | 3838804..3838923 | flank | 229 |
Gene organization within MGE regions
Location: 3815449..3838923
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HZS93_RS16510 (HZS93_03480) | - | 3815449..3816616 (+) | 1168 | Protein_3240 | IS3 family transposase | - |
| HZS93_RS16515 (HZS93_03482) | avrXacE2 | 3817376..3818446 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| HZS93_RS16520 (HZS93_03483) | - | 3818531..3819808 (-) | 1278 | WP_190416505.1 | lytic murein transglycosylase | - |
| HZS93_RS16525 (HZS93_03484) | - | 3819941..3822931 (-) | 2991 | WP_011052967.1 | Tn3-like element TnXax1 family transposase | - |
| HZS93_RS16530 (HZS93_03485) | - | 3822939..3824213 (-) | 1275 | WP_011052968.1 | tyrosine-type recombinase/integrase | - |
| HZS93_RS16535 (HZS93_03486) | - | 3824405..3825461 (+) | 1057 | Protein_3245 | DNA-binding protein | - |
| HZS93_RS16540 (HZS93_03487) | xopE | 3825595..3826671 (+) | 1077 | WP_075155146.1 | XopE/AvrPphe family type III secretion system effector | - |
| HZS93_RS16545 (HZS93_03489) | - | 3827029..3828110 (+) | 1082 | Protein_3247 | DNA-binding protein | - |
| HZS93_RS16550 (HZS93_03490) | xopAI | 3828244..3829134 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| HZS93_RS16555 (HZS93_03492) | - | 3830465..3830749 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| HZS93_RS16560 (HZS93_03493) | - | 3830977..3832092 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| HZS93_RS16565 (HZS93_03494) | - | 3832047..3832562 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| HZS93_RS16570 (HZS93_03495) | sucD | 3832649..3833524 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| HZS93_RS16575 (HZS93_03496) | sucC | 3833549..3834718 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| HZS93_RS16580 (HZS93_03497) | - | 3834950..3836563 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| HZS93_RS16585 (HZS93_03498) | pilR | 3836888..3838282 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| HZS93_RS16590 (HZS93_03500) | - | 3838505..3838672 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| HZS93_RS16595 (HZS93_03501) | pilB | 3838804..3838923 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=473102 HZS93_RS16595 WP_005915819.1 3838804..3838923(-) (pilB) [Xanthomonas citri strain T4]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=473102 HZS93_RS16595 WP_005915819.1 3838804..3838923(-) (pilB) [Xanthomonas citri strain T4]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |