Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   HT135_RS13330 Genome accession   NZ_CP054584
Coordinates   2604360..2604533 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain KKD1     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2599360..2609533
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HT135_RS13315 (HT135_13310) gcvT 2600157..2601245 (-) 1089 WP_106020089.1 glycine cleavage system aminomethyltransferase GcvT -
  HT135_RS13320 (HT135_13315) - 2601689..2603362 (+) 1674 WP_106020342.1 DEAD/DEAH box helicase -
  HT135_RS13325 (HT135_13320) - 2603382..2604176 (+) 795 WP_106020090.1 YqhG family protein -
  HT135_RS13330 (HT135_13325) sinI 2604360..2604533 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  HT135_RS13335 (HT135_13330) sinR 2604567..2604902 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  HT135_RS13340 (HT135_13335) tasA 2604989..2605774 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  HT135_RS13345 (HT135_13340) sipW 2605839..2606423 (-) 585 WP_106020092.1 signal peptidase I SipW -
  HT135_RS13350 (HT135_13345) tapA 2606395..2607156 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  HT135_RS13355 (HT135_13350) - 2607433..2607756 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  HT135_RS13360 (HT135_13355) - 2607799..2607978 (-) 180 WP_003236949.1 YqzE family protein -
  HT135_RS13365 (HT135_13360) comGG 2608046..2608420 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  HT135_RS13370 (HT135_13365) comGF 2608421..2608804 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  HT135_RS13375 (HT135_13370) comGE 2608830..2609177 (-) 348 WP_106020095.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=453716 HT135_RS13330 WP_024122036.1 2604360..2604533(+) (sinI) [Bacillus halotolerans strain KKD1]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=453716 HT135_RS13330 WP_024122036.1 2604360..2604533(+) (sinI) [Bacillus halotolerans strain KKD1]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947