Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   HT135_RS02130 Genome accession   NZ_CP054584
Coordinates   429036..429158 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain KKD1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424036..434158
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HT135_RS02115 (HT135_02115) - 425641..426324 (+) 684 WP_106021120.1 response regulator transcription factor -
  HT135_RS02120 (HT135_02120) - 426311..427735 (+) 1425 WP_101860980.1 sensor histidine kinase -
  HT135_RS02125 (HT135_02125) rapC 427904..429052 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  HT135_RS02130 (HT135_02130) phrC 429036..429158 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  HT135_RS02135 (HT135_02135) - 429263..429355 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  HT135_RS02140 (HT135_02140) - 429502..429612 (-) 111 WP_106021023.1 YjcZ family sporulation protein -
  HT135_RS02145 (HT135_02145) - 429765..431129 (-) 1365 WP_095714086.1 aspartate kinase -
  HT135_RS02150 (HT135_02150) ceuB 431515..432465 (+) 951 WP_106021021.1 petrobactin ABC transporter permease YclN Machinery gene
  HT135_RS02155 (HT135_02155) yclO 432458..433405 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  HT135_RS02160 (HT135_02160) yclP 433399..434157 (+) 759 WP_106021019.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=453685 HT135_RS02130 WP_024120213.1 429036..429158(+) (phrC) [Bacillus halotolerans strain KKD1]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=453685 HT135_RS02130 WP_024120213.1 429036..429158(+) (phrC) [Bacillus halotolerans strain KKD1]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875